ID: 1154129805

View in Genome Browser
Species Human (GRCh38)
Location 18:11727125-11727147
Sequence CAGTGAGAGCAGAGGGCACA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 639
Summary {0: 1, 1: 0, 2: 8, 3: 67, 4: 563}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154129805_1154129820 23 Left 1154129805 18:11727125-11727147 CCCTGTGCCCTCTGCTCTCACTG 0: 1
1: 0
2: 8
3: 67
4: 563
Right 1154129820 18:11727171-11727193 GCCCTGCAAGGCCCTTCCCTAGG 0: 1
1: 0
2: 5
3: 42
4: 314
1154129805_1154129815 11 Left 1154129805 18:11727125-11727147 CCCTGTGCCCTCTGCTCTCACTG 0: 1
1: 0
2: 8
3: 67
4: 563
Right 1154129815 18:11727159-11727181 CCACCCTGCCCAGCCCTGCAAGG 0: 1
1: 0
2: 14
3: 190
4: 1226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154129805 Original CRISPR CAGTGAGAGCAGAGGGCACA GGG (reversed) Intronic
900286105 1:1901438-1901460 GAGTGAGAGCAGAGGTGACTGGG + Intergenic
900880344 1:5377049-5377071 CAGTGAGACCCGAGGGCAGCTGG - Intergenic
901646513 1:10719714-10719736 CAGTGAGAGAAGAGGCAGCAGGG + Intronic
902689985 1:18105037-18105059 CACAGTTAGCAGAGGGCACAGGG - Intergenic
903216812 1:21847937-21847959 CGGTGAGAGCAGAGAGGGCAGGG - Exonic
903682673 1:25107468-25107490 AAGTGAGAGCAAAGGCCACGTGG + Intergenic
903773457 1:25778398-25778420 CAGTGAGCGAAGGGAGCACATGG + Intronic
904474445 1:30755947-30755969 GAGTGACAGCAGGGGGCAGATGG - Intronic
904728275 1:32567146-32567168 CAGTGATGGCAAAAGGCACAGGG + Intronic
904981530 1:34506953-34506975 TAGTGAGAGCACAGGGGAAAGGG + Intergenic
905291712 1:36926178-36926200 CAGTTAGGGCAGGGGGCAAAGGG - Intronic
905340223 1:37272915-37272937 CAGTGGGAGCAGGGAGCTCAGGG + Intergenic
905968036 1:42115944-42115966 TAGTCAGAGCAGAGGGAACAAGG + Intergenic
906001686 1:42431799-42431821 CTGTGGGAGCACAGTGCACAGGG - Intronic
907500355 1:54875239-54875261 CAGGGAGAGCTGTGGGTACAGGG + Intronic
907501878 1:54887075-54887097 CAGGAAGAGCAGCGCGCACACGG + Exonic
907545918 1:55259970-55259992 GAGTGAGAGCAGGGGACAAATGG - Intergenic
907612521 1:55886869-55886891 CAGTCAGAGCACAAGGCACAAGG - Intergenic
907861413 1:58357243-58357265 CAGTGAGAACAGAGGGAAATGGG + Intronic
907873335 1:58463237-58463259 CACTGAGAGCAGAGAGCTCCTGG + Intronic
908390594 1:63679977-63679999 CAGTGTGTGCAGAGATCACATGG - Intergenic
908676660 1:66612135-66612157 CAGTGTGTGCAGAGGTCACATGG + Intronic
909218798 1:72927600-72927622 TATTGAGAACAGAGGGCAAAGGG - Intergenic
909310268 1:74137890-74137912 CAATGAGAACACAGGACACAGGG + Intronic
909329651 1:74396167-74396189 CAGGGAGATCAGAGGGCAGCAGG + Intronic
910103002 1:83598626-83598648 CAGTCACAGCAGAAGGCAAAGGG - Intergenic
912663669 1:111559686-111559708 CAGTGATAGCAAAAGGAACATGG - Intronic
912884495 1:113455718-113455740 CTATGAGAGCAGATGGCACAGGG - Intronic
913116146 1:115699150-115699172 CAGTGTGTGCAGAGATCACATGG - Intergenic
913984570 1:143553194-143553216 CAATGAGAGCAGAGTCCTCAGGG + Intergenic
914000609 1:143691636-143691658 CAGCGGGAGCAGAAGGGACACGG - Intergenic
914197926 1:145459820-145459842 CAGCGGGAGCAGAAGGGACACGG - Intergenic
914477028 1:148032952-148032974 CAGCGGGAGCAGAAGGGACACGG - Intergenic
915617979 1:157055898-157055920 CAGTCATAGCAGAAGGCAAAGGG - Intergenic
915648508 1:157290824-157290846 GAGTGAGAGGAGAGGGGACTGGG + Intergenic
915654672 1:157349431-157349453 CAGTCAGAGCAGAAGGCAAAGGG + Intergenic
915724470 1:158007811-158007833 CAGAGAGAAGCGAGGGCACAGGG - Intronic
916188769 1:162158885-162158907 AAGTGAGAGAAGAGGGAATATGG + Intronic
916321434 1:163509296-163509318 CAGTAACAGCAGAGGTCACATGG + Intergenic
916379096 1:164188725-164188747 GAGTGAGAGCAGAGGACAGGAGG - Intergenic
917106588 1:171498438-171498460 CTGTGAGGGCAGAGCCCACATGG + Intronic
917174153 1:172213338-172213360 CATTGTTAGAAGAGGGCACAAGG + Intronic
917723741 1:177811009-177811031 CAGTGTGTGCAGAGATCACATGG + Intergenic
919584403 1:199418270-199418292 CATTGAGAACACAGGACACAGGG - Intergenic
920180026 1:204126953-204126975 CAGAGAATCCAGAGGGCACAGGG - Exonic
920393361 1:205625631-205625653 CTGTGAGATCAGAAGGCACCAGG - Intronic
922165951 1:223115982-223116004 CAGTAAGAGCAGAGAGAAGAGGG - Intronic
922532614 1:226356021-226356043 CAGTGAGAGCACAGTGCACCCGG + Intergenic
923193611 1:231643294-231643316 CAGTGAGATCTGAAGGGACAAGG - Intronic
923238506 1:232058180-232058202 CAGAGAGGGCAGAGGGCAGGAGG - Intergenic
923381447 1:233423534-233423556 CAGTGTGTGCAGAGGTTACATGG + Intergenic
924119866 1:240785257-240785279 CGGAGAGAGCAGCAGGCACAAGG - Intronic
1063136857 10:3224799-3224821 CAGTCATAGCAGAAGGCAAAGGG - Intergenic
1065198759 10:23293475-23293497 CAGTGTGGGCAGATGGCAGAAGG - Intronic
1066501646 10:36000716-36000738 CAGTGTGTGCAGAGATCACATGG - Intergenic
1067045627 10:42983671-42983693 CAGGAAGGGCAGATGGCACAGGG + Intergenic
1067065088 10:43099769-43099791 CAGGCAGAGAAGAGCGCACATGG - Intronic
1067703946 10:48593098-48593120 CCCAGAGAGCAGAGGGCATATGG - Intronic
1068931058 10:62590754-62590776 CAGTGACAGTTGAGGGAACAAGG - Intronic
1069208431 10:65723705-65723727 CAGTCATAGCAGAAGGCAAAGGG + Intergenic
1070874740 10:79792593-79792615 CAGTGTGTGCAGAGATCACAGGG - Intergenic
1072036826 10:91570417-91570439 CAGTGTGTGCAGAGATCACATGG - Intergenic
1072340456 10:94443278-94443300 CAGGGAGAGGAGGAGGCACATGG - Intronic
1072930609 10:99659205-99659227 CAGGGAGGGAAGCGGGCACAGGG + Intergenic
1073924465 10:108499122-108499144 CAGTGTGTGCAGAGATCACATGG + Intergenic
1074741899 10:116493404-116493426 CAATGAGAACACATGGCACAGGG - Intergenic
1074763898 10:116686718-116686740 CAGTGTGGGAAGAGGGGACAAGG - Intronic
1074765090 10:116694676-116694698 CAGAGAGTGCAGAGCGCACAGGG - Intronic
1075552865 10:123405963-123405985 CATTGAGAGCAGAGGGGAAAAGG - Intergenic
1075751826 10:124778664-124778686 CAGTGAGCAGAGATGGCACATGG + Intronic
1076120941 10:127935938-127935960 AGGTGAGAGCAGAGGGAAGAAGG - Intronic
1076412623 10:130262723-130262745 CAGTGAGAGGAGGAGGCAGAGGG - Intergenic
1076412846 10:130264164-130264186 CAGTGAGAGGAGGAGGCAGAGGG - Intergenic
1076474784 10:130744309-130744331 CAGGGAGGGCAGAGGGCAGGAGG - Intergenic
1076591771 10:131588466-131588488 CAGAGAGAGCCCAGGGAACAGGG + Intergenic
1076848664 10:133082368-133082390 CAGTGAGAGAGGAGGCCACGTGG + Intronic
1077083800 11:737411-737433 CAGTGAGACCAGAGGGAACACGG - Intergenic
1077382477 11:2250639-2250661 CTCTGAGAGCTGAGGTCACAGGG + Intergenic
1077399246 11:2345487-2345509 CAGTGTGTGCAGAGGTCACATGG + Intergenic
1078546337 11:12249672-12249694 CAGTGAGAGCAGAATGTGCAGGG - Intronic
1078706187 11:13746465-13746487 CAGTCAGAGCAGGGGTCACATGG + Intergenic
1079090057 11:17474666-17474688 CCAGGAGAGCAGAGGGAACACGG - Intronic
1079205816 11:18413405-18413427 CAGAGAGGGAGGAGGGCACAAGG - Intronic
1079396857 11:20071156-20071178 CAATGAGAACACATGGCACATGG - Intronic
1080428651 11:32178738-32178760 CTTTGGGAGCAGAGGGCAGAAGG - Intergenic
1080687080 11:34524728-34524750 CAGGGAGAGGAAAGGGCACCTGG - Intergenic
1081299478 11:41433038-41433060 CATTGAGAGGAGAAGACACAGGG - Intronic
1081511628 11:43780081-43780103 CAGGGAGTGGAGAGGGCACTGGG - Intronic
1081668340 11:44929499-44929521 CAGTGAGGAGAGAGGGCCCAGGG - Exonic
1081905450 11:46666657-46666679 CAGTTAGCTCACAGGGCACAAGG + Intronic
1082609745 11:55282454-55282476 CAGGGAGAGAAGAAGGCAGAGGG - Intergenic
1082656938 11:55868071-55868093 CAGGGAGAGAAGAAGGCAGAGGG + Intergenic
1082673611 11:56067860-56067882 CAATGAGAACACATGGCACATGG - Intergenic
1083737879 11:64691990-64692012 CAGTGACAGCAGAGGGCTAGAGG + Intronic
1084045094 11:66563792-66563814 CAGGGTGAGCAGAGGGCACTGGG - Exonic
1084407186 11:68980911-68980933 CAGAGGGAGCACAGTGCACACGG - Exonic
1084462114 11:69301970-69301992 CAGTGAGGTCAGAGGGCTCCCGG - Intronic
1084954373 11:72683648-72683670 CAGACAGTGCAGGGGGCACAGGG + Intergenic
1085288972 11:75383855-75383877 CAGTGAGCGGAGATGGCGCATGG - Intergenic
1085313814 11:75531451-75531473 CAGTGAGAGGAGAGTGTGCAGGG + Intergenic
1087277328 11:96173691-96173713 CAGCGATGGCAGAGGCCACAGGG + Intronic
1088105127 11:106198260-106198282 CAGTCATAGCAGAAGGCAAAGGG - Intergenic
1088294633 11:108278631-108278653 CAGTGTGTGCAGAGATCACATGG + Intronic
1088848613 11:113687897-113687919 CAGGGAGGGGAGAGGGCAGAAGG + Exonic
1089067519 11:115673168-115673190 CAGTGAGAGCAGCTGGCCCGAGG - Intergenic
1089679326 11:120110578-120110600 CAGTGAGAACAGAGGGGCCCGGG + Intergenic
1090231487 11:125109844-125109866 CAGTTAGAATAGAGGGCAAATGG + Intronic
1090493446 11:127187299-127187321 TGGGGAGAGCAAAGGGCACAGGG - Intergenic
1090803644 11:130189539-130189561 CTGTGAGAGCAGAGGGCAAAGGG + Intronic
1091364309 11:135004983-135005005 TAGTGACAGCAGAGGGGAGAAGG - Intergenic
1091624582 12:2112360-2112382 CAGTGAGTGCAGGGAGGACAGGG + Intronic
1091699099 12:2648363-2648385 CAGTGGCAGAAGAGGGCAAAAGG - Intronic
1092136052 12:6148008-6148030 CAGTGGGAGCAGAGAGCACTGGG - Intergenic
1092166479 12:6345849-6345871 CAGCCAGAGGAGAGGGCACTGGG + Intergenic
1092555584 12:9557666-9557688 AAGTGAAATCACAGGGCACATGG - Intergenic
1092616194 12:10218119-10218141 CAGTAAGGTCAGAGGGCACTAGG - Exonic
1094207917 12:27860086-27860108 CATTGAGAGAAGACGGCAGAAGG - Intergenic
1094516514 12:31133009-31133031 AAGTGAAATCACAGGGCACATGG + Intergenic
1095344930 12:41139180-41139202 CACTGAGAACACAGGACACAGGG + Intergenic
1096088977 12:48885657-48885679 CAGTGAAAGCTGAGGGCAGAGGG + Intergenic
1096582918 12:52600038-52600060 CAGTGAGTGGAGAGGAGACAGGG - Intronic
1097474505 12:60036760-60036782 CAGTGTGTGCAGAGATCACATGG - Intergenic
1097492823 12:60291561-60291583 GAGAGAGACCAGAGAGCACAGGG - Intergenic
1098194278 12:67983456-67983478 CAGGGTGTGCAGAGGTCACATGG - Intergenic
1098237166 12:68428360-68428382 TAGAGATAGCAGAGGGCTCATGG + Intergenic
1100393675 12:94165886-94165908 AAGTGAGGGAAGAGGGCAAACGG + Intronic
1100778282 12:97996190-97996212 CAGTGTGTGCAGAGATCACATGG - Intergenic
1100799267 12:98213994-98214016 CCATGATAGCAAAGGGCACAAGG + Intergenic
1100856608 12:98762826-98762848 CAGTGAGACCAGAGCCCTCAAGG - Intronic
1101259958 12:103019030-103019052 CAGTGTGTGCAGAGATCACATGG + Intergenic
1101604560 12:106238321-106238343 CAGTGGGGACAGAGGGCACCGGG + Exonic
1101637941 12:106561762-106561784 CAGTGTGTGCAGAGATCACAGGG - Intronic
1101817982 12:108160461-108160483 CAGTCATAGCAGAAGGCAAAGGG + Intronic
1102038831 12:109787710-109787732 CAGTGAGAAAAAAGGGCCCAAGG - Intronic
1102162011 12:110777017-110777039 CAGTGAGTGCAGAGATTACAAGG + Intergenic
1102406160 12:112676122-112676144 CGTAGAGATCAGAGGGCACAAGG - Intronic
1102459106 12:113089323-113089345 GAGTGAGAGCAGAGGACAGATGG + Intronic
1102624482 12:114224075-114224097 AAGTTGGAGCAGAGAGCACAGGG + Intergenic
1102670547 12:114615267-114615289 AGGTGAGAGCAGAGGTGACAGGG + Intergenic
1102984244 12:117265511-117265533 CTGTGGGAGGAGAGGGGACAGGG + Intronic
1102993339 12:117330397-117330419 CAGTGGGAGCAGAGGGGTCAAGG - Exonic
1104015328 12:124958052-124958074 CATGGAGAGGAGTGGGCACAGGG + Intronic
1104172817 12:126298907-126298929 CAGTGTGTGCAGAGATCACATGG + Intergenic
1104225064 12:126823530-126823552 CGGAGAGAGGAGAGGGAACAAGG - Intergenic
1106097493 13:26660930-26660952 CTGTGTGTGCAGAGGTCACATGG + Intronic
1106333067 13:28756945-28756967 CAGTGAGAGTAGAGGAGAGAAGG - Intergenic
1106588164 13:31074998-31075020 CAGTGTGTGCAGAGATCACATGG - Intergenic
1107424310 13:40277423-40277445 GAGAAAGAGCAGAGGGCTCAGGG - Intergenic
1108725718 13:53178726-53178748 CAATGAGAGCAAAGGAAACACGG + Intergenic
1110026880 13:70551634-70551656 CAGTGAGAGCATAGGTCCTATGG - Intergenic
1110980399 13:81890016-81890038 CAGTGCCAGCAGAGGGCAAGAGG - Intergenic
1111240184 13:85463737-85463759 CAGTCATAGCAGAAGGCAAAGGG + Intergenic
1112175430 13:97018771-97018793 CAGGGTGAGCACAGGGCCCAGGG - Intergenic
1113201738 13:107874030-107874052 CAGGGAAAGCAGAGTGGACAGGG + Intergenic
1114417590 14:22554750-22554772 CAGTTAGGGCAGAGGTCAGAGGG + Intergenic
1114461983 14:22892319-22892341 CAGAGAAAGAAGAGGGAACAAGG + Intergenic
1114587679 14:23829188-23829210 CAGGCAGAGCAGAGAGCACTGGG - Intergenic
1117490210 14:56239775-56239797 CAGTGAGAGCACAGAGCTCAGGG + Intronic
1117581764 14:57158302-57158324 TAGTGAGGGGAGAGGACACATGG - Intergenic
1118284151 14:64455816-64455838 CAGTGTGAGCTGAGGGCAGCAGG - Intronic
1118860437 14:69658815-69658837 CAGGGAGAGCAGAGGGTGGAGGG + Intronic
1119402078 14:74369706-74369728 TAATGAGAGCAGAGGACCCAGGG - Intergenic
1119853016 14:77879470-77879492 CAGTGTGTGCAAAGGGCCCATGG + Intronic
1120156400 14:81098135-81098157 CAGTGTGGGCAGGGAGCACATGG - Intronic
1120501321 14:85300595-85300617 CAGTGAGAGCAGAAGCTACAAGG + Intergenic
1120649557 14:87115421-87115443 CAGGGAAAGCAGAGGGAAAAGGG - Intergenic
1121215706 14:92246102-92246124 CAGTGTGTGCAGAGACCACATGG + Intergenic
1121371823 14:93365740-93365762 CAGTGAGAAAAAAGGGCACATGG + Intronic
1121463983 14:94102441-94102463 GAGGGTGAGCACAGGGCACAGGG - Intronic
1122116594 14:99530646-99530668 AAGGGACAGCAGAGGGCACATGG + Intronic
1122483991 14:102065981-102066003 CAGGGCCATCAGAGGGCACAGGG + Intergenic
1122875225 14:104660801-104660823 AAGTGAGAGCAGAGGGCGCTGGG - Intergenic
1122961630 14:105096510-105096532 AGGTGAGAGAAGAGGGCTCAGGG - Intergenic
1124040311 15:26095901-26095923 CTGAGAGAGCAACGGGCACAAGG + Intergenic
1124171199 15:27375460-27375482 CAGGGACAGCCGAGGGCATAAGG + Intronic
1124252612 15:28116932-28116954 CAGGGAGCACAGAGGCCACATGG - Intronic
1124347784 15:28934003-28934025 CAGAGAGAGCAGCTTGCACACGG + Intronic
1124406944 15:29401504-29401526 CAGTGATGGCAAAGGGCAGAGGG + Intronic
1124687346 15:31793419-31793441 CAGTGAGGAGAGAGGACACAGGG - Intronic
1125516154 15:40322583-40322605 CAGGGAGAGCAGAGAGCGGAAGG + Intergenic
1125841834 15:42809137-42809159 GAGTGAGAACAGAGGGCAGGTGG - Intronic
1126653452 15:50950814-50950836 CAATGAGAACATAGGACACACGG - Intronic
1127138775 15:55952727-55952749 CAGTGAGAACAGATGACGCAAGG - Intronic
1127393896 15:58528279-58528301 GAGTGAGAGCAGAGGTGACCTGG - Intronic
1127550565 15:60033660-60033682 CAGTCATAGCAGAAGGCAAAGGG - Intronic
1127566499 15:60194280-60194302 CAGGAAGAGGAGAGGGAACAGGG - Intergenic
1128343869 15:66841898-66841920 CGGTGAGAAGACAGGGCACACGG - Intergenic
1128478918 15:68020583-68020605 CAGGCAGAGCAGAAGGCAGAAGG - Intergenic
1129535794 15:76312705-76312727 CAGTGAGAGAAGAGGGCAGTGGG - Intergenic
1130878184 15:88032291-88032313 CACTCAGACCAGAGGGCTCAGGG - Intronic
1130949971 15:88578478-88578500 GAGTGAAAGAAGAGGACACATGG + Intergenic
1131290374 15:91101581-91101603 CAGTGAGAGCAGAGAGGAGGAGG + Intronic
1132413078 15:101600205-101600227 CAGTGTCAGCAGAGGCCACGTGG - Intergenic
1132765362 16:1531713-1531735 GCGTGACAGCTGAGGGCACAGGG + Intronic
1132808335 16:1786097-1786119 CAGAGGCAGCAGAGGGCCCAGGG - Intronic
1132839283 16:1971015-1971037 GAGTGGGTGCAGAGGGCAGAGGG - Intergenic
1132956453 16:2596853-2596875 CAGGCAGAGCAGAGGGGCCAGGG + Intronic
1133228492 16:4354845-4354867 CAGTGAGACCAGGGGAGACAGGG + Exonic
1133255079 16:4511749-4511771 CAGTGAGGACACAGGGCAGACGG + Exonic
1133739901 16:8643519-8643541 CAGTGAGGGCAGGGGGCCCCGGG + Intronic
1134691395 16:16192898-16192920 CAGTGAGGGCGGAGGGCCCCAGG + Exonic
1134858790 16:17542505-17542527 CAGTCAGAGGAGAGGGCCCAAGG - Intergenic
1135325636 16:21523745-21523767 CAATGTGTGCAGAGGGAACACGG + Intergenic
1135684445 16:24487138-24487160 TAGTCAGAGCTGTGGGCACACGG + Intergenic
1135899977 16:26448484-26448506 TAGTCAGAGCTGGGGGCACACGG - Intergenic
1136011152 16:27364041-27364063 CCATGAGAGTAGAGGGCACTGGG + Exonic
1136049030 16:27637628-27637650 CAGTGAGAGCAGCGGGCACTGGG + Intronic
1136933143 16:34436470-34436492 CAGTGAGAGGAGAGGGCCCTGGG - Intergenic
1136971429 16:34975344-34975366 CAGTGAGAGGAGAGGGCCCTGGG + Intergenic
1137427834 16:48394712-48394734 TACTGAGAGAACAGGGCACAAGG + Intronic
1137803520 16:51283084-51283106 CAGTGAGACGGGAGGTCACAAGG - Intergenic
1138226349 16:55298723-55298745 CTGTGAGAATAGAGGGCAAAGGG - Intergenic
1138235645 16:55380179-55380201 CAGGGAGAGCAGAGGGGGAAGGG - Intergenic
1138452771 16:57103647-57103669 CAGTGAGAGAGGCAGGCACAGGG - Intronic
1138542878 16:57699065-57699087 GCTGGAGAGCAGAGGGCACAGGG + Intronic
1138713670 16:58997613-58997635 CAGTCAGGGCAGAGGGGACTTGG + Intergenic
1139301054 16:65945666-65945688 CAGTCAGAGCAGTGAGCACAGGG - Intergenic
1139390951 16:66605835-66605857 CACTCAGGGCAGAGGGCAGAAGG + Intronic
1140870161 16:79099052-79099074 CAGTGTGTGCAGAGATCACATGG + Intronic
1141118959 16:81335966-81335988 CACTGAGAGCAAAGGGCATAAGG - Intronic
1141368705 16:83467670-83467692 CACAGACAGCAGAGGGCAGAAGG - Intronic
1141618761 16:85225356-85225378 CAGTCAGTGCAGAGGGCCCGAGG + Intergenic
1142023939 16:87802218-87802240 CAGTGTGTGCAGATGGCAGATGG - Intergenic
1142308868 16:89300475-89300497 CAGAGAGAGCAGAGTGCAGCAGG - Intronic
1142481967 17:224501-224523 CAGTTGTAGCAGAGAGCACAGGG - Intronic
1142540477 17:654926-654948 CAGTGAGAGCAGCGGCCAGAGGG - Intronic
1142981056 17:3671922-3671944 GAGTGAGAGAAGAGGCCACAGGG + Exonic
1143003888 17:3814264-3814286 CAGTGAGAGCAGAGGACAGTGGG - Intronic
1143130205 17:4672890-4672912 CAGGGCGTGCCGAGGGCACAGGG + Exonic
1143384926 17:6523521-6523543 CAGTGAGAGCTAAGGGCAGTCGG - Intronic
1143483758 17:7241601-7241623 CTGTGAGATCAGAAGGCACCAGG + Exonic
1143851777 17:9818225-9818247 CAATCATAGCAGAGGGCAGAGGG + Intronic
1144081286 17:11766599-11766621 CTGTGAGAGCCCAGGGGACATGG + Intronic
1144341089 17:14310774-14310796 CAATCAGAGAAGAGGGCACCAGG - Intronic
1144388621 17:14772859-14772881 AACTGAGAGCAGAAGGCAGAAGG + Intergenic
1144607201 17:16677401-16677423 CTGTGAGTGCAGATGGCTCAGGG + Intergenic
1144652858 17:17018221-17018243 CAGGGAGCGCTGTGGGCACATGG - Intergenic
1144839329 17:18175936-18175958 CAGTGAGGGCAGAGGGCCCAGGG - Intronic
1145065821 17:19760442-19760464 CAGTGTGAGCTGAAGGCGCATGG - Intergenic
1145276121 17:21431881-21431903 CAGTGTGCACAGAGGTCACAGGG - Intergenic
1145313965 17:21717795-21717817 CAGTGTGCACAGAGGTCACAGGG - Intergenic
1145750957 17:27354475-27354497 CAGGGAAGGCAGAGGGGACAGGG - Intergenic
1145825447 17:27873765-27873787 GAGGGAGAGCACAGGGAACACGG - Intronic
1145964956 17:28910496-28910518 CATTGAGTGCAGAGCGTACAAGG + Intronic
1146747363 17:35344256-35344278 GAGTGAGAGGACAAGGCACAGGG - Intergenic
1146759452 17:35463975-35463997 CAGTGTGTGCAGAGATCACAAGG + Intergenic
1147219475 17:38919994-38920016 CAGTGAGAGGGGAGGGCTCCTGG + Exonic
1147370901 17:39992361-39992383 GTGTGAGGGCAGAGGGCAGAGGG - Intronic
1147555195 17:41474540-41474562 CTGGGAGTGCAGAGGGCTCAGGG - Intergenic
1147910764 17:43854581-43854603 CAAGGAGATCAGAGGGCACTAGG - Intronic
1147918227 17:43901040-43901062 GACTGAGAGCAGAGGTCAGAGGG - Intronic
1147937926 17:44024230-44024252 CAGGCAGAGCAGAGAGCCCAGGG + Intergenic
1149577556 17:57724982-57725004 CAGTGAGAGCACAGATCTCATGG - Intergenic
1150155972 17:62853439-62853461 CAGTCATAGCAGAAGGCAAAGGG + Intergenic
1150709266 17:67516088-67516110 CAAAGAGAGGAGAGGTCACAGGG - Intronic
1151365015 17:73611546-73611568 CCATGTGAGCAGAGGCCACAGGG - Intronic
1151671029 17:75571796-75571818 CAGGGAGAGCAGAGGGTGCTCGG + Intronic
1151781338 17:76248093-76248115 CAGAGAGAGGAAAGGGCTCAGGG - Intergenic
1152224806 17:79087748-79087770 CAGTGAGGGAAGAGGCCACCAGG + Intronic
1152685090 17:81689995-81690017 CAGTGAGGACAGAGGCCCCATGG + Intronic
1153780811 18:8493606-8493628 CAGTGAGAGCACCAGGCAAAGGG - Intergenic
1154109381 18:11552656-11552678 GGGTGAGAGCAGTGGGCACACGG - Intergenic
1154129805 18:11727125-11727147 CAGTGAGAGCAGAGGGCACAGGG - Intronic
1154176975 18:12092247-12092269 GGGTGAGGGCAGTGGGCACAGGG + Intergenic
1155340852 18:24812688-24812710 CACAGAGAGAAGAGGGCAGAAGG - Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156294120 18:35774482-35774504 CACTGGGAGTAGAGGACACAGGG - Intergenic
1156461952 18:37326210-37326232 AAGGGAGAGCAGAGGGGTCAGGG + Intronic
1157566701 18:48683401-48683423 CACTTCGAGCAGGGGGCACAAGG + Intronic
1157695984 18:49724050-49724072 CACTGAGATCAGAGTGCAAATGG - Intergenic
1158143263 18:54280291-54280313 CAGTGTGTGCAGAGATCACATGG + Intronic
1158605662 18:58893833-58893855 CAGAGAGAGCAGTGGTTACATGG + Intronic
1158829310 18:61260238-61260260 GAGTGAGAGCAGAGGAGAAAGGG - Intergenic
1158878389 18:61753557-61753579 CAGTCATAGCAGAAGGCAAAGGG - Intergenic
1160362564 18:78296281-78296303 CAGTGTGAGCTGGGGGCACGGGG + Intergenic
1162095849 19:8309551-8309573 CAGGGTGTGCAGAGGCCACAAGG - Intronic
1162818263 19:13208767-13208789 CAGCGAGGGCCGAGAGCACATGG - Exonic
1163999247 19:21082244-21082266 CTCTGCGAGCAGAGGACACAGGG - Exonic
1164326317 19:24195536-24195558 CAGTAAGAGCAGAAGTCATAAGG - Intergenic
1164477360 19:28585888-28585910 CGGTGGGAGCAGAGGGCACCTGG - Intergenic
1164876502 19:31694281-31694303 CAGTGAGAGGAGAGCCCACAGGG - Intergenic
1164952524 19:32349324-32349346 CAGTGAGCCTAGAGGGCAAATGG + Intronic
1165181279 19:33973079-33973101 CAGTGTGTGCAGAGACCACACGG - Intergenic
1165423722 19:35734351-35734373 CAGTGAGAGCAGGTGGCACAGGG + Intronic
1165661089 19:37580728-37580750 CAGTGTGTGCAGAGATCACATGG - Intronic
1165719574 19:38069503-38069525 CAGAGAGAGCAGAGAGAAGAGGG - Intronic
1166312079 19:41968764-41968786 AAGTGAGGGCCGGGGGCACATGG - Exonic
1166560724 19:43730919-43730941 AAGTGAGAGCAGAAGACACGAGG + Exonic
1166580485 19:43894243-43894265 CAATGAGAACACATGGCACAGGG - Intronic
1167651776 19:50734890-50734912 GAGGGAGAGAAGAGGGCAGAGGG - Intergenic
1167837487 19:52086087-52086109 CAGAGAGAGGAGAGGACAAAAGG + Intronic
1168101003 19:54140942-54140964 CAGAGAGAGAAGAGGTCTCATGG - Intronic
925140402 2:1546392-1546414 CAGTAAGCCCACAGGGCACAAGG - Intergenic
925305769 2:2847117-2847139 AAATGAGGCCAGAGGGCACAGGG - Intergenic
925708185 2:6710577-6710599 CAGTGTGTGCAGAGACCACATGG - Intergenic
925841635 2:7997474-7997496 CAGCGAGACCACATGGCACATGG - Intergenic
927711798 2:25330750-25330772 CCGGGAGAGCAGAGGGCATGGGG - Intronic
929093754 2:38244899-38244921 CTGAGAGAGGAGAGGGCAGAAGG + Intergenic
929717869 2:44331673-44331695 CAGTGGGAGCATAGAGCAAAGGG - Intronic
930358267 2:50347001-50347023 CGGGGAGAGGAGAGGGCGCAGGG + Intronic
930948342 2:57105292-57105314 CTGTGAGAGCAGAGGCCACAGGG + Intergenic
931201395 2:60100668-60100690 CAGAAGGAGGAGAGGGCACATGG + Intergenic
931801751 2:65765519-65765541 CAGAGAGAGCTGGGGACACATGG - Intergenic
932064902 2:68544744-68544766 TAGTGATTGAAGAGGGCACATGG + Intronic
932313856 2:70767211-70767233 CAGGGAGAGGAGAGGGAAGATGG + Intronic
932704092 2:74010027-74010049 CAGTGGGAGGAAAGGCCACAGGG - Intronic
932746560 2:74338419-74338441 CAGTGAGAGAGGAGGGCAATGGG + Intronic
933267684 2:80199920-80199942 CAGGGAGAGCAGAGGGCAGGAGG + Intronic
933649262 2:84836434-84836456 CAGTGAGAGCAAAGCAGACAAGG - Intronic
933759559 2:85664422-85664444 CAGTGAGAGGTGATGGGACAGGG - Intronic
934489666 2:94752724-94752746 CAGAGAGAGCAAAGGGAACTTGG - Intergenic
934514484 2:94977689-94977711 CAGTGAGAGGAGTGAACACAGGG - Intergenic
934664184 2:96158462-96158484 CAGGGAGAGCAGAGGCCCCATGG + Intergenic
934725073 2:96611290-96611312 CAGTAAGAGCACAAGACACAAGG + Intronic
934845880 2:97661042-97661064 GAGTGAGAGCAGGGTGCACAAGG - Intronic
935153782 2:100464098-100464120 CAGTGAGAGGAGAAGCTACAAGG - Intergenic
935263068 2:101371409-101371431 CAGGGAGAGCAGAGGCCAAAGGG + Intronic
935351055 2:102152092-102152114 CAGTGAGCTTAGAGGGCACATGG + Intronic
935606762 2:104979373-104979395 CAGCGAGAGCAGAGTGAACAAGG - Intergenic
935631415 2:105215585-105215607 CAGTAAGAGCAGAGGCTACAAGG - Intergenic
936014368 2:108946621-108946643 CAGTCATAGCAGAAGGCAAAGGG + Intronic
936173489 2:110197492-110197514 CAGGGTGAGCAGGGGGCCCACGG + Intronic
937174218 2:119910766-119910788 CAGTCACAGCAGAAGGCAAAGGG - Intronic
939959590 2:148554589-148554611 CAGTGACAGCAAAGGCCCCAGGG - Intergenic
940203209 2:151174182-151174204 CAGTGAGAGCTGAGGCCTGACGG - Intergenic
942489263 2:176473714-176473736 CACTGTGAGCAGAGGTCACCAGG + Intergenic
944390079 2:199208887-199208909 CAGTGAGAGCTGAGGCCCCACGG - Intergenic
945176988 2:207053031-207053053 CAGGAAGAGCAGATGCCACAAGG + Intergenic
945778387 2:214135770-214135792 CAGTGTGTGCAGAGATCACATGG - Intronic
945934735 2:215891684-215891706 CTGTGAGAGCAGACCACACAAGG + Intergenic
947011912 2:225575267-225575289 CAGTGACAGCAGAGGCCTGAAGG - Intronic
947083118 2:226420819-226420841 GAGTGGGAGCTCAGGGCACAGGG + Intergenic
948204401 2:236155525-236155547 CAGGGAGACCAGTGGGCACGGGG - Intergenic
949035940 2:241815781-241815803 CAGAGAGAGCGGAGGGCAGGCGG - Intronic
1168764576 20:373014-373036 CAGTGAGAGCTGAGGATAAAGGG - Intronic
1169267254 20:4174275-4174297 GAGGGAGAGCAGAGGGTCCAGGG + Intronic
1169448183 20:5689532-5689554 CTTTGAAAGTAGAGGGCACAGGG + Intergenic
1170792179 20:19517369-19517391 CAGTGAGTCCAGAGGGGAGATGG - Intronic
1171003536 20:21439707-21439729 AAGTGAGAAAAGAGGGCATAAGG - Intergenic
1171181519 20:23094341-23094363 CAGTGAGAGCAGAATTCAGATGG - Intergenic
1171222502 20:23412291-23412313 AACTGGCAGCAGAGGGCACAAGG + Intronic
1171296155 20:24018963-24018985 CTGTGAGAGCAGCTGCCACAAGG - Intergenic
1171365273 20:24618313-24618335 CAGTGAGGGCAGAGAGCCCAGGG + Intronic
1171471899 20:25378872-25378894 TAATGAGAGCAGAGGGCAGATGG - Intronic
1172271151 20:33656521-33656543 CAGACAGAGGAGACGGCACATGG - Intergenic
1172966679 20:38840440-38840462 CAGTGAGAGCAGTGAGCATGGGG - Intronic
1173139600 20:40470663-40470685 CAGTAAGAACAGAGTGCACTGGG + Intergenic
1173553562 20:43949786-43949808 CAATGACAGAAGCGGGCACAGGG - Intronic
1175254216 20:57629166-57629188 GAGTGCGAGCACATGGCACAGGG + Intergenic
1175290821 20:57874000-57874022 CAGAGGGAGCACACGGCACATGG + Intergenic
1175379980 20:58556231-58556253 CAGTGAGAGCAGAGGGCCAGAGG + Intergenic
1175621993 20:60455103-60455125 CAGTGAAACCAGAGGACAGATGG + Intergenic
1175730718 20:61352130-61352152 TAGTGAGGGCAGAGTGCAGACGG - Intronic
1175738848 20:61406452-61406474 CAGGCAGAGCAGATGGCAGATGG - Intronic
1175738853 20:61406480-61406502 CAGGCAGAGCAGATGGCAGATGG - Intronic
1175738867 20:61406550-61406572 CAGGCAGAGCAGATGGCAGATGG - Intronic
1175738895 20:61406690-61406712 CAGGCAGAGCAGATGGCAGATGG - Intronic
1175738942 20:61406921-61406943 CAGGCAGAGCAGATGGCAGATGG - Intronic
1175966713 20:62663491-62663513 CGGTGTGAGCAGAGGCGACATGG + Intronic
1176820637 21:13652057-13652079 CAGGAAGAGCAGATGGCACTGGG + Intergenic
1176926648 21:14758253-14758275 CAGTGAGGGCTAAGAGCACATGG - Intergenic
1177425090 21:20912515-20912537 CAGTCATGGCAGAAGGCACAGGG + Intergenic
1177677171 21:24315911-24315933 CTCTGAGGGCAGAGGACACAAGG + Intergenic
1177745483 21:25207891-25207913 CAGTCAGGGCAGAAGGCAAAGGG - Intergenic
1178296849 21:31417391-31417413 CAGTCACAGCAGAAGGCAAAAGG + Intronic
1178361212 21:31949819-31949841 CAGTGTGTGCAGAGATCACATGG + Intronic
1178441538 21:32602538-32602560 CAGTGAGAGTCCAGGGCTCAGGG - Intronic
1178449815 21:32687385-32687407 CAGTAAGGGCAGATGGCAAAGGG + Intronic
1178563793 21:33664335-33664357 TAGAGAGTGCAGAGGTCACATGG + Intronic
1179186853 21:39091488-39091510 CTGAGAGAGGAGAGGGGACAGGG - Intergenic
1179497269 21:41780508-41780530 CAGTGTGAGCACAGTCCACAGGG + Intergenic
1179682024 21:43029282-43029304 GATGGAGAGCAGAGGCCACAGGG - Intronic
1179716535 21:43291453-43291475 CACTCAGAGAAGAGGGCAGAAGG + Intergenic
1179828612 21:43982166-43982188 CACTGACAGCAGAGGCCACTGGG + Intronic
1180097382 21:45563067-45563089 CAGTCAGAGCAGAGATCTCATGG + Intergenic
1180836156 22:18930517-18930539 CAGTGAGTGTAGAGGGCAGTTGG + Intronic
1181465779 22:23109908-23109930 CGGGGACAGCACAGGGCACATGG - Intronic
1181983043 22:26779842-26779864 CAGAGAGAACAGAGTGCACAAGG - Intergenic
1182547741 22:31085503-31085525 CAGCGAGGGCAGAGAGTACACGG + Intronic
1182956505 22:34431624-34431646 CATTGAGAACTGCGGGCACATGG + Intergenic
1183214323 22:36469319-36469341 CAGTGGCTACAGAGGGCACAAGG + Intronic
1183455811 22:37922439-37922461 CAGTCAGGGCAGGGGGCACCGGG + Intronic
1183554306 22:38513253-38513275 CAGTGACAGCAGGGGGAGCAGGG - Intergenic
1183573970 22:38675217-38675239 CAGTGAGAGCAAAGGGAGCCTGG - Intergenic
1183906978 22:41049078-41049100 CAGAGAGAGCAGAGGCAAGATGG + Intergenic
1183985637 22:41568771-41568793 CAGAGAGACCAGAGAGCAGAAGG - Intronic
1184106697 22:42371551-42371573 CATCGAGAGCAGAGGCCCCAGGG + Intergenic
1184335491 22:43850590-43850612 GAGGGAGAGCAGAGGGAACAGGG - Intronic
1184559756 22:45255387-45255409 CAGGGAGGGGAGAGGGCTCAGGG - Intergenic
1184767568 22:46579648-46579670 CAGGGAGGGGAGGGGGCACACGG - Intronic
1184795782 22:46731646-46731668 CAGGGAGGGCAGAGGGCACCTGG + Intronic
1184873476 22:47257518-47257540 AAGAGAGAGCACACGGCACATGG - Intergenic
1185015638 22:48341046-48341068 AAGGGAGAGCGGTGGGCACATGG + Intergenic
1185199688 22:49494092-49494114 CAGTTGGAGCAGAGAGCAGAGGG + Intronic
1185305901 22:50115947-50115969 CAGGGAGAGCGAAGGGCTCAAGG - Intronic
1203286248 22_KI270734v1_random:155816-155838 CAGTGAGTGTAGAGGGCAGTTGG + Intergenic
949516530 3:4812547-4812569 AACTGAGAGAAGAGGGCACTTGG - Intronic
950622861 3:14220311-14220333 CAGTGAGAGCAGTGTGCAGATGG - Intergenic
952550048 3:34466515-34466537 CAATGAGATCAGTGGACACAGGG - Intergenic
952713101 3:36452019-36452041 CAGTGAGAGCAAAGCAGACAGGG - Intronic
953187215 3:40649288-40649310 TAGTGAGAGCAGAGGCTGCAAGG - Intergenic
953230157 3:41057763-41057785 CCGTGAGTGGAGAGGGAACATGG - Intergenic
953262755 3:41356143-41356165 CAGGGAGAACACAGGGGACAGGG - Intronic
953477977 3:43222030-43222052 CAGTCATACAAGAGGGCACAGGG + Intergenic
953559301 3:43972174-43972196 CAGTGAGAGGGGAGGGCTCCTGG - Intergenic
953788525 3:45929228-45929250 CAGTGACACCAGGGGGCAGAAGG - Intronic
953904211 3:46860394-46860416 CAGTGACAGCAGTGGGCAGTGGG - Intronic
954380826 3:50218190-50218212 CAGAGAGAGCTTGGGGCACATGG + Intronic
954581155 3:51703571-51703593 CAGTCAGGGTAGAGGGCAGAGGG + Intronic
956175719 3:66471469-66471491 CAGTGGGAGCAGGGAGCACCTGG - Intronic
956353654 3:68366375-68366397 CAGAAAGAACAGAGGGCACAAGG + Intronic
956377721 3:68633817-68633839 CAGTGATAGCAGAGGTCACACGG + Intergenic
956519204 3:70085027-70085049 CAGTGATGGCAGAGGGGAGAGGG + Intergenic
956866764 3:73376799-73376821 CACTGTAAGCAGAGGCCACAAGG - Intergenic
957891480 3:86364493-86364515 CAGGAAGAGCAGAGGGGTCAAGG + Intergenic
959368017 3:105488142-105488164 CAGTGTGTGCAGAGATCACATGG - Intronic
959580340 3:107976866-107976888 CAGTTTGAGCAGAGGGCCCTTGG - Intergenic
959865575 3:111266234-111266256 CAGTAAGATCAGAGGATACAAGG - Intronic
961244131 3:125436743-125436765 CAGTGTGAGGACAGGGCACTGGG + Intergenic
961528934 3:127527637-127527659 GTGTGAGACCAAAGGGCACAGGG - Intergenic
962847576 3:139285550-139285572 CAGTGAGAGCAGAGGTCCCGAGG - Intronic
963015198 3:140817269-140817291 CAGTGGGGGCAGGGGGCATATGG + Intergenic
963229704 3:142896594-142896616 CAGTGAGTGAGGAGAGCACAGGG - Intergenic
963633835 3:147768267-147768289 CAGTGATGGCAGAAGGCAAAGGG - Intergenic
963751149 3:149181179-149181201 CAGGGAGAGCAGGGGCCAGATGG - Intronic
963817159 3:149844277-149844299 CAGTGAGAAGAAAAGGCACATGG + Intronic
964148687 3:153497763-153497785 CAGCGAGAGCTGAGGGGAGAGGG - Intronic
964485851 3:157184668-157184690 CACTCAGAGCAGAAGGCAGAAGG - Intergenic
964847001 3:161055098-161055120 AAGTCAGAGCAGGGGGTACAAGG + Intronic
964850713 3:161093452-161093474 TAGTGAGAGCACAGGGCAGCTGG + Intronic
965084505 3:164077476-164077498 CAGGGAAAGCAGAGGGAAAAAGG + Intergenic
965389222 3:168084217-168084239 CAATGATGGCAGAGGGCAAAGGG - Intronic
965557779 3:170035678-170035700 GAGTTAGAGCAGAGGGCATGGGG - Intergenic
965561662 3:170067619-170067641 CTGTGATTGCAGAGGTCACATGG - Intronic
965743049 3:171896937-171896959 AGGTGAGAGGAGAGGTCACAGGG + Intronic
965894950 3:173564132-173564154 CAGTGAGTGCAGAGGCCCTATGG - Intronic
966192211 3:177281519-177281541 CAGTGTGTGCAGAGGTCACATGG + Intergenic
966875945 3:184321754-184321776 CAGTTGGAGCAATGGGCACAGGG - Exonic
967208298 3:187144403-187144425 CAATCATAGCAGAGGGCAAAGGG + Intronic
967322335 3:188207173-188207195 TAGTGAGAGAAGTGGGCAGATGG - Intronic
967612171 3:191520369-191520391 CAGTGAGAGGTGAGGGCAAATGG + Intergenic
967847174 3:194053424-194053446 CAGTGAGAGATGAGGTCACAGGG + Intergenic
968127290 3:196169337-196169359 CAGAGACAGCAGAGGCCACCTGG + Intergenic
968651657 4:1762543-1762565 GAGTCAGGGCAGAGGGCAGAAGG + Intergenic
968665855 4:1822049-1822071 CAGTGAGAGGAGATGGTGCAAGG - Intronic
968958370 4:3730461-3730483 CAGTGGGGGCTGGGGGCACAGGG + Intergenic
970069505 4:12141277-12141299 AATTGAGAGTGGAGGGCACAGGG + Intergenic
970146534 4:13042059-13042081 CAAAGAGACCAGTGGGCACATGG + Intergenic
970654700 4:18218232-18218254 CAGTGAGAGCATAGGCTACAAGG - Intergenic
972395887 4:38659640-38659662 CAGTGTGTGCAGAGATCACAGGG + Intergenic
972756278 4:42050359-42050381 CAGTGGGAGGAGAGGGGATAGGG + Intronic
972758247 4:42073852-42073874 CAGTGAGAGGAGATCACACAAGG + Intronic
972783578 4:42306905-42306927 CAGTGACAGCAGCCGGCAGATGG - Intergenic
975392616 4:73836800-73836822 CAGCGCGAGCAGCGCGCACAAGG - Exonic
976072357 4:81256383-81256405 CAGTGTGAGTCGGGGGCACATGG - Intergenic
976423289 4:84870701-84870723 AAGTGAGACCAGAAGGCAAAGGG - Intronic
976821209 4:89209078-89209100 CAGTGTGTGCAGAGATCACATGG + Intergenic
979928175 4:126594254-126594276 GAGTGAGGGCAGAGGGTATATGG + Intergenic
980829006 4:138106958-138106980 CAGTGAGAAAAGAGGGCAGCTGG + Intergenic
981977655 4:150750000-150750022 CAGCAAGAGCAGAGGCCATAAGG - Intronic
982122539 4:152156779-152156801 GAGTGAAAGTAAAGGGCACACGG + Intergenic
984495959 4:180497480-180497502 AAGTGTGAGGAAAGGGCACACGG - Intergenic
985091128 4:186363654-186363676 CAGTGATAGGTGAGGCCACATGG - Intergenic
985825132 5:2185824-2185846 CAGTGAGAGCAGGCGGCCCTGGG + Intergenic
985927981 5:3032754-3032776 CAGAGAGAGTGGAGGCCACACGG - Intergenic
986150905 5:5129743-5129765 CAGCAAGGGCAGAGGGCAGATGG - Intergenic
986434721 5:7717867-7717889 CATGCAGAGCAGAAGGCACATGG + Intronic
986734047 5:10655163-10655185 CAGGGAGAGAAGCGGGCAGAGGG - Intergenic
987137875 5:14916778-14916800 CAGTCATAGCAGAAGGCAAAAGG - Intergenic
987646470 5:20678891-20678913 CAGACAGAGATGAGGGCACAGGG + Intergenic
988957697 5:36335449-36335471 CGGTGAGAGGAGAGATCACAAGG + Intergenic
988959333 5:36353923-36353945 AAAAGAGAGCAGAGGGCAGAAGG + Intergenic
990748493 5:58985533-58985555 CACTGAGAGCTTAAGGCACATGG - Intronic
991116668 5:62963145-62963167 CAGTGTGTGCAGAAGTCACATGG + Intergenic
993080986 5:83300773-83300795 CAATGAGAACATATGGCACAAGG - Intronic
993108579 5:83627834-83627856 GAGTGAGAGGAGAGAGAACAGGG - Intergenic
993130830 5:83896244-83896266 CAGAGGGAGCAGAGGGAGCAGGG + Intergenic
994305044 5:98192876-98192898 GAGTGTGAGCAGAGAGCAAAGGG + Intergenic
994439540 5:99784931-99784953 GTGTGAGAGCAGAGGAAACATGG - Intergenic
995727416 5:115196041-115196063 CAGTGAAAATAGATGGCACACGG + Intergenic
996102738 5:119461017-119461039 AAGTGAGAGATGAGGGCAGAGGG + Intronic
997127500 5:131242902-131242924 CATTGTGAACAAAGGGCACAGGG + Intergenic
997847251 5:137298182-137298204 CAGTGAGAGGAAAAGGCACCTGG - Intronic
997894059 5:137700052-137700074 CAGTCAGAGAAGAGAGAACAGGG - Intronic
998162826 5:139822988-139823010 CAGTGAGAGCAGCTGGGCCACGG + Intronic
998275950 5:140753584-140753606 CAGTGGCAGCAGAGGGTTCATGG + Intergenic
998881738 5:146652261-146652283 TAGTGAGAGCACAGGGAGCATGG - Intronic
999175583 5:149629554-149629576 CAGTGACAGGAGAGGGCAGGAGG + Intronic
999291299 5:150428181-150428203 CAGCCAGAGCAGAGGTCCCATGG + Intergenic
999586230 5:153092688-153092710 CTGTGAGAGCAGAGGGAGCCAGG - Intergenic
999643171 5:153691982-153692004 GAGTGAGAGCTGATGCCACAGGG - Intronic
1000005837 5:157184192-157184214 CAATGAGAGATAAGGGCACATGG + Intronic
1000043448 5:157502255-157502277 CAGTGAGTGTGGAGGGTACACGG - Intronic
1000149177 5:158482861-158482883 AAGTGAGTGCAGAGGACCCACGG - Intergenic
1000859875 5:166444729-166444751 CAGTGAGAACACATGACACAGGG - Intergenic
1001536708 5:172503177-172503199 CAGTGTGAGCAGAGGGATCCAGG + Intergenic
1001600329 5:172924168-172924190 CAGAGAGGGCAGAGGGCACTGGG - Intronic
1002374082 5:178775707-178775729 CAGGGGCAGCTGAGGGCACAAGG + Intergenic
1002567449 5:180119804-180119826 CAGTGAGAGGAGAAAGCCCAGGG - Intronic
1002703292 5:181142456-181142478 CAGTCAGATCAGAGGGCTGAGGG - Intergenic
1003667111 6:8121682-8121704 CAGTGTGGGCAGCAGGCACATGG - Intergenic
1004952974 6:20694926-20694948 CAGTGTGTGCAGGGGTCACAGGG - Intronic
1005869372 6:29962813-29962835 CAGGGAGATCAGGGGGCAAAAGG + Intergenic
1006104810 6:31710199-31710221 CGGGGAAAGAAGAGGGCACATGG + Intronic
1006151841 6:31994046-31994068 CACTAAGAGCAAAGGGAACAGGG - Intronic
1006158142 6:32026784-32026806 CACTAAGAGCAAAGGGAACAGGG - Intronic
1006350248 6:33515708-33515730 CAGTTACAGCAGAGACCACACGG + Intergenic
1006375321 6:33668640-33668662 AAGTGCGGGCAGGGGGCACAGGG - Intronic
1007446662 6:41911693-41911715 CGGCGAGAGCAGAGGTCATATGG + Intronic
1010062263 6:71636394-71636416 CAGTGACTGCAGAGGCCACAGGG - Intergenic
1010475072 6:76276687-76276709 AAGTGAGGGGAAAGGGCACAGGG - Intergenic
1010685542 6:78850761-78850783 CAGCTAAAGAAGAGGGCACATGG + Intergenic
1011744469 6:90396328-90396350 CAGTGAGCGCTGAGGGCATATGG + Intergenic
1012359678 6:98361724-98361746 CAGTGAGGTCAGAGGGAAGAAGG + Intergenic
1012925512 6:105263357-105263379 CTGTGAGAGGGGAGGACACAGGG + Intergenic
1014687121 6:124515429-124515451 CAGTGTGTGCAGAGATCACATGG + Intronic
1015691626 6:135930537-135930559 CAGTGAGGACTGAGGGCCCATGG + Intronic
1015831024 6:137369150-137369172 CACTCACAGCAGAGGGCAGAGGG + Intergenic
1016008442 6:139113223-139113245 CAGTGACAGTAGAGGCCTCAAGG + Intergenic
1016933372 6:149430123-149430145 CACAGAGAGCAGTGGGTACATGG + Intergenic
1017275750 6:152565971-152565993 TGATGGGAGCAGAGGGCACAGGG + Intronic
1018268907 6:162055205-162055227 CAGATAGGGGAGAGGGCACAGGG + Intronic
1018634608 6:165849683-165849705 CTGTGAGAGCCGGGGGCCCAGGG + Intronic
1019229246 6:170544286-170544308 CTGTGAGAACAGAAGACACAGGG + Intronic
1020223135 7:6256821-6256843 CAGAGGGAGCAGAGTCCACATGG - Intronic
1020469480 7:8519642-8519664 GAGAGAGAGAAGAAGGCACAAGG - Intronic
1021668771 7:23014063-23014085 CAGTGAGAGGAGGGGGAAGATGG - Exonic
1022838226 7:34136978-34137000 CAGAGAAAGCAGAGAGCAGAGGG + Intronic
1022850497 7:34256873-34256895 GAGTCAGAGAAGAGGGAACAAGG - Intergenic
1023070316 7:36425027-36425049 CACAGAGAGAAGAGGGCTCAGGG - Intronic
1023103217 7:36739791-36739813 CAGGCAGTGCAGAGGGCTCATGG - Intergenic
1023139909 7:37091579-37091601 CAGTGAGAGTGGAGGGGGCAGGG - Intronic
1023330019 7:39105088-39105110 CATCAAGAGCAGAGGGCAGATGG + Intronic
1023943131 7:44782821-44782843 CAGTGAGGGCAGATGGCAGAGGG + Intergenic
1024268703 7:47626083-47626105 CAGTGAGAGCAGAGAGAGAAAGG + Intergenic
1024323883 7:48093775-48093797 CAGGGGGAGCAGCGGGGACAGGG - Intronic
1024916617 7:54507427-54507449 CAGTGTGTGCAGAGATCACATGG - Intergenic
1024992614 7:55248074-55248096 GAGTGAAAGCAGAGGTCTCAAGG + Intronic
1025028214 7:55535371-55535393 CAGTGAGCTCAGAGGGCACTGGG + Intronic
1025973788 7:66353503-66353525 CAGTGAGAGAAGACGTTACAGGG - Intronic
1027493879 7:78863394-78863416 CAGTGTGTGCAGAGATCACATGG + Intronic
1027496579 7:78894342-78894364 CAGTGAGCGGAGATCGCACATGG + Intronic
1027721228 7:81744026-81744048 AAGTGAGAGCAGAAGGGATATGG - Intronic
1028267749 7:88748596-88748618 CAGTGATAGCTGAGAACACATGG - Intergenic
1028466663 7:91160224-91160246 AAGGCAGAGCCGAGGGCACAGGG - Intronic
1029478361 7:100798636-100798658 CAGGGAGGGCAGAAGGAACAGGG + Intergenic
1029555280 7:101264605-101264627 CTCTGAGAGCTAAGGGCACATGG - Intergenic
1029596848 7:101542577-101542599 CACTCAGAACAGAGGGCAGAGGG - Intronic
1030527108 7:110667537-110667559 CAGTGAAAGCAGGAGGCAGAAGG + Intronic
1030762139 7:113365023-113365045 CAGTCATAGCAGAAGGCAAAGGG - Intergenic
1030973478 7:116090914-116090936 CAATGAGAACATAGGGCACAGGG + Intronic
1031110749 7:117605665-117605687 CAATGAGAGCTGAGGGGAAAGGG + Intronic
1031121539 7:117727980-117728002 CAGTGACAGGAGGTGGCACAAGG + Intronic
1031188605 7:118516729-118516751 CTGTGAGAAAAGAGGGTACAAGG - Intergenic
1032547518 7:132756128-132756150 CTTTGGGAGCAGAGGGCAGAAGG - Intergenic
1033146831 7:138878340-138878362 CAGTGAGAGGAGAGGCCCCTGGG + Intronic
1033321735 7:140346037-140346059 TAGTGAGACTAGAGGGCAAATGG - Intronic
1034267991 7:149790423-149790445 CAGTGAGGGCCGCGGGCGCAGGG - Intergenic
1034417577 7:150973286-150973308 CAGACAGAACAGAGCGCACAGGG + Intronic
1034471798 7:151258709-151258731 AGGTGAGAGCAGAGGGGACAGGG - Intronic
1034697488 7:153066759-153066781 CACTGAGAGCAGAGAGAACCTGG + Intergenic
1034981679 7:155482998-155483020 CTGGGAGTGCAGGGGGCACATGG + Intronic
1035056560 7:156040087-156040109 GAGTGAGAGCAGAGGGCCCAGGG + Intergenic
1035402236 7:158574486-158574508 CACTGAGAGGAGGGGCCACAAGG + Intronic
1035725113 8:1819525-1819547 CAGTGAGGGCACAGTGCTCAAGG - Intergenic
1036428399 8:8667296-8667318 CAATGTCAGCAGAGGCCACATGG - Intergenic
1036486319 8:9182654-9182676 CAGGGAGAGCAGAGGTGTCAGGG - Intergenic
1037816709 8:22116359-22116381 CAGAGAGGGCAGAGGTCTCAGGG + Exonic
1038026039 8:23591642-23591664 CAGTGAGAACATAGGGGAAAGGG + Intergenic
1038061378 8:23917598-23917620 CAGTGACAACAGAGGAAACAAGG - Intergenic
1038311582 8:26449561-26449583 GAGTGAGCGAAGAGGGGACAAGG + Intronic
1038499949 8:28035528-28035550 CACTGTGTGCAGAGGTCACATGG - Intronic
1038568317 8:28638135-28638157 CAGGGAGAGTAGGGGGCCCAGGG - Intronic
1039159116 8:34596890-34596912 CAGTCATAGCAGAAGGCAAAGGG + Intergenic
1039798187 8:40933092-40933114 CCGTGAGAGCAGAGCGCCCTGGG + Intergenic
1040006834 8:42628132-42628154 CAGGGGGAGCAGAGGGACCAGGG - Intergenic
1040697753 8:50022749-50022771 CAGTGGGAACAGAGGCAACATGG - Intronic
1040855317 8:51942962-51942984 CAGTGAGTGGAGAGGGGACCAGG - Intergenic
1041007975 8:53514510-53514532 CAGGGAGAGGTGAGGACACAGGG + Intergenic
1041159055 8:55018583-55018605 CAGTGTGAGCGGAGGCCACATGG + Intergenic
1044177257 8:89142725-89142747 TAGTGGGAGCAGAGGGCATGGGG - Intergenic
1044656248 8:94551578-94551600 CCTTGAGAGCATAGGGCAGATGG - Intronic
1044712694 8:95072865-95072887 CAGGGAGGGCAGTGGGCACCTGG + Intronic
1045005783 8:97915501-97915523 CAGTTAGATAACAGGGCACAAGG - Intronic
1046617643 8:116495080-116495102 CAGTGGGAGAAGAGGGTACAAGG - Intergenic
1046768414 8:118095217-118095239 CAGGGATAACAGAGGGCAAAAGG - Intronic
1048348541 8:133596977-133596999 CAGGGGGAGCAGAGGGTAAACGG - Intergenic
1048715593 8:137265226-137265248 CAGTGATAGCATAGGGAAAATGG + Intergenic
1049083116 8:140457876-140457898 GAGGGAGAGAAGAGGGGACAGGG + Intronic
1049181603 8:141225869-141225891 GAGTCAGAGCTGAGGGCAAAGGG - Intronic
1049421683 8:142519415-142519437 GCTGGAGAGCAGAGGGCACAGGG - Intronic
1049511970 8:143032292-143032314 TAGTGAGAGCTGCGGTCACACGG - Intergenic
1050744227 9:8858043-8858065 CAGCGAGAGAAGCGGGCGCAGGG - Intronic
1052413849 9:28152333-28152355 CAATGTGTGCAGAGGTCACATGG - Intronic
1053138152 9:35664735-35664757 CAGTGAGTGGAAGGGGCACAGGG - Exonic
1053201049 9:36151760-36151782 CAGGGGGAGCCCAGGGCACAGGG - Intronic
1053917932 9:42957817-42957839 CAGAGAGAGCAAAGGGAACTTGG + Intergenic
1054913210 9:70473043-70473065 CAGAGACAGGAGAGGTCACATGG - Intergenic
1055269382 9:74540241-74540263 CAGAGTGAGCAGAGGGGGCAGGG - Intronic
1055413446 9:76056394-76056416 CCGTGTGAGGAGAGGGCAAAAGG + Intronic
1055783607 9:79847312-79847334 CAGAGAGAACAAAGGGCAAAGGG - Intergenic
1056523371 9:87420554-87420576 GAGAGAGAGAAGAGGGAACAAGG + Intergenic
1056733832 9:89187506-89187528 CAGTGATAGCAGAGGGCCTAAGG - Intergenic
1057212978 9:93210555-93210577 GAGTGAGAGCAAAGGTCACGAGG - Intronic
1057403223 9:94743015-94743037 CAGAAAGAGAAGAGGGCCCACGG + Intronic
1057595581 9:96413572-96413594 CAGTCTTAGTAGAGGGCACAGGG + Intronic
1057839939 9:98478237-98478259 GAGTCAGAGCAGAGACCACATGG - Intronic
1058638034 9:107055971-107055993 CAGTGGGAGTAAAGGGCACCTGG + Intergenic
1059150383 9:111944333-111944355 CACTGAGAGCAGTGAGCACGTGG + Intergenic
1059282329 9:113145562-113145584 CAGAGAGAACAGAAGGGACAGGG + Intergenic
1059421139 9:114193153-114193175 CAGGGAGGGGAGAGGGCTCAAGG + Intronic
1059449183 9:114359650-114359672 CAGGGAAAGCAGAGGCCACCAGG - Exonic
1059917721 9:119122349-119122371 CAGTAAGAGCACAGGGAATAAGG - Intergenic
1060211306 9:121712141-121712163 CAGAGAGAGGAGAGGGCACTGGG + Intronic
1060398819 9:123335500-123335522 CTGTGAGGGCAGAGGGCAGGTGG - Intergenic
1060815419 9:126632656-126632678 CAGAGAGGGAACAGGGCACAGGG + Intronic
1061048487 9:128180363-128180385 GAATGAGAGCACAGGGCACCCGG + Intronic
1061250198 9:129421950-129421972 CAGGGAGAGCAGTGGGGACAAGG - Intergenic
1061887429 9:133598939-133598961 CAGGGAGAGCCCAGGGCAGATGG + Intergenic
1062464649 9:136675670-136675692 CTGGGAGAGCAGAGGGGAGACGG - Intronic
1185490942 X:516579-516601 CAGTGAGAGGAGGGGGGAGAAGG - Intergenic
1186081238 X:5935460-5935482 CAGTGAATGCAGAGAGGACAGGG + Intronic
1186466864 X:9790147-9790169 CCTTGATTGCAGAGGGCACAGGG + Intronic
1187030186 X:15478777-15478799 AAGTGTGAGCAGAAGGCAGAGGG - Intronic
1187073579 X:15912248-15912270 TAGTGATAGTAGAGGGAACAGGG + Intergenic
1187225786 X:17374923-17374945 CAGTAAGCGCAGAGGGAAGAGGG - Intergenic
1188606630 X:32039493-32039515 CAGTGAGATTTGGGGGCACAAGG - Intronic
1190946415 X:55098630-55098652 CAGTCAGAGAAGAGGACATAGGG - Intronic
1192463431 X:71337535-71337557 CAGTGAAAGCAGTGGGAACAGGG - Intergenic
1193715788 X:84934138-84934160 CTGTGAGATCAGAGGCCACTGGG - Intergenic
1193854065 X:86576899-86576921 CACTCAGAGCAGAAGGCAAAAGG - Intronic
1194765436 X:97842775-97842797 CAGTAAGAGAAAAGGGAACATGG - Intergenic
1195961783 X:110394648-110394670 CAGAGACAGCAGAGAGCAAAGGG + Intronic
1196792262 X:119474787-119474809 CACTGAGTGCAGAGGGCCCTTGG - Intergenic
1197161215 X:123324517-123324539 CAGTGGGAGTTGAGGGGACATGG - Intronic
1197293687 X:124690769-124690791 CAGTGTGTGCAGAGATCACAAGG - Intronic
1197314440 X:124947221-124947243 CATTAAGTGCAGAGGGCTCAGGG + Intronic
1197769761 X:130082569-130082591 CCGTGAGCGCTGAGGGCACGTGG - Intronic
1199575133 X:149306634-149306656 CTGTGTCACCAGAGGGCACATGG + Intergenic