ID: 1154132721

View in Genome Browser
Species Human (GRCh38)
Location 18:11750771-11750793
Sequence GTGGGCAGGAGGAAAACTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 522
Summary {0: 1, 1: 0, 2: 3, 3: 62, 4: 456}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154132715_1154132721 -2 Left 1154132715 18:11750750-11750772 CCTTTCTAACTCTTGGCTGCGGT 0: 1
1: 0
2: 0
3: 2
4: 87
Right 1154132721 18:11750771-11750793 GTGGGCAGGAGGAAAACTGGTGG 0: 1
1: 0
2: 3
3: 62
4: 456

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154132721 Original CRISPR GTGGGCAGGAGGAAAACTGG TGG Intronic
900163548 1:1235779-1235801 GTGGGCAGGTGGGAACCTGGAGG - Intergenic
900936726 1:5770801-5770823 GTGTGCAGGTAGAAAAGTGGGGG - Intergenic
901641863 1:10696663-10696685 GTGTGTAGGAGGAAGCCTGGAGG + Intronic
902330617 1:15729518-15729540 GTGGGCAGGACGTCAACGGGTGG - Intronic
902342928 1:15796129-15796151 GAGGGGAGGAGGAAGACAGGAGG + Intergenic
903468835 1:23570786-23570808 CAGGGCAGGAGAAAGACTGGAGG + Intergenic
903885507 1:26538838-26538860 GTGGGCATTAGGGACACTGGTGG - Intronic
904129754 1:28267038-28267060 GTAGGGTGGAGCAAAACTGGGGG - Intronic
904266205 1:29319794-29319816 TAGGTCAGGAGGAAGACTGGGGG + Intronic
904949361 1:34223844-34223866 GTGTCCAGGAAGAAAACTGGAGG - Intergenic
905990980 1:42336598-42336620 AGGGGTATGAGGAAAACTGGAGG + Intergenic
906166254 1:43688652-43688674 TGGGGCAGGAGGAAGAATGGAGG + Intronic
906460076 1:46030202-46030224 GAGAGCAGGAAGAGAACTGGCGG - Exonic
907326432 1:53641426-53641448 CTGGGGAGGAGGAAAACAGGTGG + Intronic
908271210 1:62424435-62424457 GTGGGCAGGAAGAACACGTGTGG - Intergenic
909476205 1:76083469-76083491 GTGGGCAGTAAGAAGACTGTGGG + Intronic
909601872 1:77469465-77469487 GTGGGCAGGCTGGAAACTGTTGG - Intronic
910483713 1:87686620-87686642 GTTGGCTGGAGTAAAGCTGGTGG + Intergenic
910806923 1:91197698-91197720 GCGGGTAGGAGGAAGTCTGGAGG + Intergenic
910993544 1:93079816-93079838 GAGGGCAGGAAGGAACCTGGGGG + Intronic
911452431 1:98080726-98080748 GTGGGTAGGAGGAAATGGGGTGG - Intergenic
911737896 1:101357653-101357675 GGGGACAGGAGGCAAGCTGGAGG + Intergenic
913697491 1:121341660-121341682 GTAGGCAAGAGGAAGAGTGGTGG + Intronic
914140068 1:144938392-144938414 GTAGGCAAGAGGAAGAGTGGTGG - Intronic
916075887 1:161199872-161199894 GTGGGGAGGGGGAACCCTGGGGG - Intronic
916104365 1:161420110-161420132 GTGGGAAGGAAGAAAAATGAAGG + Intergenic
916579626 1:166095674-166095696 GGGGGCAGGAGGAAAAGGGCAGG + Intronic
918730728 1:187992538-187992560 GTGAGGAAGAGGAAAAATGGGGG + Intergenic
919988269 1:202690986-202691008 GTGAGTAGGACGAGAACTGGAGG - Intronic
920292052 1:204929993-204930015 GAGGGCAGGAGGGGAAGTGGCGG + Intronic
920292836 1:204936073-204936095 TTGGGCAGGAGGAGAACAGGTGG - Intronic
920484880 1:206360309-206360331 GTAGGCAAGAGGAAGAGTGGTGG + Intronic
920807106 1:209245355-209245377 GGGGGAAGGAGGAAGATTGGAGG + Intergenic
921511749 1:216039984-216040006 GTGGGCAGGGGGAAAGAGGGAGG - Intronic
922988753 1:229886929-229886951 GGAAGCTGGAGGAAAACTGGAGG + Intergenic
924357542 1:243197853-243197875 ATGGGCATGAAGAAAACTGCTGG + Intronic
924380542 1:243459835-243459857 CTGGGCAGGAGGATCACTTGAGG - Intronic
924493033 1:244558731-244558753 GTGGGCAGGAGGAGAAGGGGAGG - Intronic
924717458 1:246590488-246590510 GAGGGCAGCAGGAGAAGTGGTGG + Intronic
1063600449 10:7475761-7475783 GAGGGAAGGAGGGAGACTGGTGG - Intergenic
1063817002 10:9787074-9787096 ATGTGCAGGAGGTAAACTGCAGG + Intergenic
1065171336 10:23033565-23033587 GTGTGCATGAGGAAAAGAGGAGG + Intronic
1065829155 10:29598607-29598629 GATGGCAGAGGGAAAACTGGGGG - Intronic
1067226425 10:44379203-44379225 ATGGGCATGAGGAAGCCTGGAGG + Intronic
1068253200 10:54470453-54470475 TAGGGCAGGATGCAAACTGGTGG + Intronic
1068792635 10:61043935-61043957 CAAGGCAGGAGGATAACTGGAGG + Intergenic
1069225156 10:65933892-65933914 CTGGGTAGGAGGAAATCTGCTGG + Intronic
1069534817 10:69245350-69245372 CAGGGCAGGAGAAACACTGGAGG + Intronic
1069766956 10:70869492-70869514 GCTGGCAGGCGGAAAGCTGGGGG - Intronic
1069860669 10:71469260-71469282 AGGGGCATGAGGAAACCTGGGGG - Intronic
1070668181 10:78359984-78360006 GTGAGCAGGAGGGAGCCTGGGGG + Intergenic
1070694490 10:78551922-78551944 ATGGGCAGGAGGGAAGGTGGGGG + Intergenic
1071070800 10:81691214-81691236 GTGACCAGGAGTAAAACTGCTGG + Intergenic
1071526488 10:86362666-86362688 GTTGGAAGGAGGAATTCTGGGGG - Intronic
1072521898 10:96236587-96236609 CAGGGCAGGAGGATCACTGGAGG + Intronic
1072914151 10:99526929-99526951 ATGGGCAGGAGGGAAACAGGTGG + Intergenic
1073063736 10:100746470-100746492 GAAGGCAGGAGAGAAACTGGAGG - Intronic
1073441950 10:103557405-103557427 GGGGGCAGGAGGATCACTTGCGG + Intronic
1073495177 10:103884255-103884277 GTCGGCAGTAGTCAAACTGGGGG + Intronic
1075756659 10:124817648-124817670 GTGGTCAGGGTGAAAACTGCAGG - Intronic
1076893496 10:133296893-133296915 TTGGGGATGAGGAAAACAGGTGG + Intronic
1078524753 11:12091790-12091812 GAGGGCGTGAGGGAAACTGGTGG - Intergenic
1078992487 11:16664147-16664169 GTGGGGAGGATGAAGAGTGGAGG - Intronic
1079118990 11:17664435-17664457 ATGGACAGGAGGAAAATTTGGGG + Intergenic
1079845976 11:25468175-25468197 GAGGGCAGCAGGAGAAGTGGTGG + Intergenic
1080711073 11:34748562-34748584 GAGGGCAGGAGGAAGGCTGGAGG + Intergenic
1080844340 11:36013861-36013883 TGGGGCAGCAGCAAAACTGGTGG - Intronic
1081512021 11:43784464-43784486 GGGGGCAGCAGGAGAAATGGTGG + Intronic
1081596980 11:44466327-44466349 GGGGGCAGGAGGAAAAGCAGGGG - Intergenic
1081862375 11:46340600-46340622 ATGAGCAGGAGGAAACCTGGAGG - Intronic
1082264951 11:50108294-50108316 GTGGGCAGAAGGAGGACTGGAGG - Intergenic
1082276408 11:50226737-50226759 TTTGGCAGGAGGATAATTGGGGG - Intergenic
1082965609 11:58963781-58963803 GAGGCCAGGAAGAAAAGTGGCGG - Intronic
1083701155 11:64478442-64478464 GGAGGCAGGAGGAAGACAGGAGG + Intergenic
1084424424 11:69076841-69076863 GAGGGCAGGAGGGCAAGTGGAGG - Intronic
1084424433 11:69076874-69076896 GAGGGCAGGAGGGCAAGTGGAGG - Intronic
1084424492 11:69077065-69077087 GAGGGCAGGAGGGCAAGTGGAGG - Intronic
1084424502 11:69077098-69077120 GAGGGCAGGAGGGCAAGTGGAGG - Intronic
1084648381 11:70473926-70473948 GTGGGAAGGAGCACACCTGGAGG + Intronic
1085147172 11:74211959-74211981 GTGGGGAGGACGACAAGTGGAGG - Intronic
1086896260 11:92316344-92316366 GTTGGCAGGAGTATAACTGTTGG + Intergenic
1087938243 11:104060997-104061019 GTGGGAAGGAGGAAATGGGGAGG - Intronic
1089051551 11:115550030-115550052 GTGGTCAGAGGGAAAACTGGAGG - Intergenic
1089201904 11:116729703-116729725 TTGGGCAGGAGGAATCCAGGAGG + Intergenic
1089396881 11:118141904-118141926 GTGGAGAGGAGGAAGACTGTGGG - Intronic
1089580337 11:119477728-119477750 GAGGGGAGGAGAAAAAGTGGAGG + Intergenic
1089643625 11:119863983-119864005 GAGGGCAGGAGGAAGGCAGGGGG - Intergenic
1089763374 11:120745134-120745156 GTGACCAGGATGAAAACTGGAGG - Intronic
1090075155 11:123576039-123576061 GTGGGCAGGAGGGGAGCTGGGGG - Intronic
1090398429 11:126434021-126434043 GTGGGCAGGGGGAGAGCAGGGGG + Intronic
1091568413 12:1663764-1663786 GAAGGAAGGAGGAAAACAGGAGG + Intergenic
1091568424 12:1663800-1663822 GAGGGAAGGAGGAAAACAGGAGG + Intergenic
1091568434 12:1663835-1663857 GAAGGAAGGAGGAAAACAGGAGG + Intergenic
1092114763 12:5992137-5992159 GTGGGGAGGATGAAGATTGGTGG - Intronic
1092577157 12:9798257-9798279 GTGGTCAGGAGGTAAAGTGCTGG + Intergenic
1092680273 12:10971185-10971207 GTAGGGAGGAGGAAAACAAGAGG - Intronic
1092781437 12:11991347-11991369 CTGTGCAGGAGGCAAACTTGGGG - Intergenic
1094008640 12:25783107-25783129 GTGACCAGGAGGAAACCTGCAGG - Intergenic
1094424859 12:30306856-30306878 GTAGGCAGGAGGAACACTTGAGG + Intergenic
1095508902 12:42928010-42928032 CTGGGCAGAAGAAGAACTGGGGG + Intergenic
1095939697 12:47717970-47717992 CTGGGCAGGAAGAAGCCTGGGGG - Intronic
1095980618 12:47972426-47972448 GGGGGCAGGAGGAATATGGGTGG + Intergenic
1096180691 12:49548942-49548964 GTGGGCCGGAGGCCAGCTGGAGG + Exonic
1096388403 12:51210765-51210787 GTGGGCTGAATGAAATCTGGTGG - Intronic
1098495911 12:71135407-71135429 GAGAGCAGGAGGAAAACAAGAGG + Intronic
1098517449 12:71393884-71393906 GATGGCAGGAGGTAAACTGGAGG - Intronic
1099150846 12:79111304-79111326 TAAGGCAGGAGAAAAACTGGTGG - Intronic
1101131562 12:101696649-101696671 GAGGGCTGTAGGAAAACAGGTGG + Intergenic
1101283039 12:103279252-103279274 ATGGGCAGGAGGAAACTTGGAGG + Intronic
1101756203 12:107622318-107622340 GTGGTCAAAAGAAAAACTGGAGG + Intronic
1101845777 12:108361939-108361961 GGGGGCAAGAGGATAAATGGGGG + Intergenic
1103211363 12:119169239-119169261 GGGAGCAGGAGGAAGACTGGAGG - Intergenic
1103502740 12:121416284-121416306 GTGGGTAGGTGGAAAACTCAGGG - Exonic
1103513896 12:121494343-121494365 GTGGTCACTTGGAAAACTGGGGG - Intronic
1104721959 12:131049354-131049376 GTGTGCAGGAGGCACACAGGTGG - Intronic
1104849020 12:131862303-131862325 GTGGGCAGGGGGCACTCTGGAGG + Intergenic
1105585731 13:21741205-21741227 GTGGGCAGGAGGAACACTCTAGG - Intergenic
1105623449 13:22090673-22090695 GTGAGCAGGAGAAGAACAGGTGG + Intergenic
1105898380 13:24737137-24737159 GTGGGCAGCAGGGAAACCTGTGG + Intergenic
1106727150 13:32497638-32497660 GAGTGCTGGAGGAAAAATGGAGG + Intronic
1107557817 13:41533290-41533312 GTGGGCAAGAGGAACACGGTAGG - Intergenic
1108173359 13:47766987-47767009 GGAGGCAGGAGTAATACTGGTGG - Intergenic
1108485341 13:50917907-50917929 GTGGGAAGCAGGAAAAATTGTGG - Intronic
1108918373 13:55644322-55644344 GGGGGCAGTAAGAAAACTGAAGG - Intergenic
1109229819 13:59743198-59743220 ATGGACAGGAGGACAACTGGAGG + Intronic
1109698933 13:65999548-65999570 GTGAGCAGGCAGAAAACAGGAGG - Intergenic
1109977523 13:69858258-69858280 TTGGGGAGGAGAAAGACTGGGGG + Intronic
1110308318 13:74016593-74016615 TAGGGCAGGAGGAACACTTGAGG - Intronic
1110635478 13:77762630-77762652 CGAGGCAGGAGGAAAACTTGAGG - Intronic
1111268926 13:85854371-85854393 GTGGGTATGAGGAAACCTGGTGG - Intergenic
1112109991 13:96285911-96285933 GAGGGAAGGAGGGAAAGTGGGGG - Intronic
1112429352 13:99336917-99336939 GTGGGAAGGAGGAAGAGAGGTGG - Intronic
1112610806 13:100952931-100952953 GAGGGCAGCAGGAAGACTGCTGG - Intergenic
1114700601 14:24674220-24674242 GTGGGGAGCAGGAGAAATGGGGG - Intergenic
1117047568 14:51828456-51828478 GGGGGCAGGAGGAAAAAAGGAGG + Intronic
1119745498 14:77040834-77040856 GGGAGCAGGAAGAAAGCTGGGGG - Intergenic
1121055113 14:90845763-90845785 GGGGGCAGGAGGAGAAATGCTGG + Intergenic
1121057108 14:90865696-90865718 GTGGGCAGCAGGAAAAGCTGGGG + Exonic
1121358443 14:93233791-93233813 GTGGAGAGGAGGGAAACTGAAGG - Intergenic
1121445530 14:93976514-93976536 CAGGGCAGAAGGAAAACTCGGGG - Exonic
1121467634 14:94126280-94126302 GGGGGCAGAAGGACAGCTGGGGG + Intergenic
1121786918 14:96668873-96668895 CTGGGCAGGAGGAAACTGGGAGG + Intergenic
1121817164 14:96937700-96937722 TTGGGAAGGAGAGAAACTGGAGG - Intergenic
1122012269 14:98759982-98760004 GAGCTCAGGAGGAAAAATGGGGG - Intergenic
1124422050 15:29531127-29531149 GTAGGTAAGAAGAAAACTGGGGG - Intronic
1125361829 15:38872832-38872854 GTGAGGAGGAGGACCACTGGAGG + Intergenic
1126118303 15:45228770-45228792 GCTGGAGGGAGGAAAACTGGAGG + Intergenic
1126255047 15:46615524-46615546 GTGTGCAGAAGTAACACTGGAGG - Intergenic
1126389810 15:48135220-48135242 GTGGGGAGAAGGAAAAGTGGTGG - Exonic
1127126907 15:55820628-55820650 GTGGGCAGGAGCAAACATGTGGG - Intergenic
1127252328 15:57253338-57253360 GTGACCAGCAGGCAAACTGGTGG - Exonic
1127467054 15:59254419-59254441 GGGGGCAGGAGGATCACTTGAGG - Intronic
1127540979 15:59938761-59938783 GTGGGCAGCAGACAGACTGGAGG + Intergenic
1128711895 15:69878401-69878423 GGGGGCAGGGGGAAAAGTGGGGG + Intergenic
1129264922 15:74388396-74388418 CAGGGCAGGAGTAAAAATGGAGG - Intergenic
1129603232 15:77012326-77012348 GTGGACAGGTGGACAAATGGAGG - Intronic
1130095384 15:80851701-80851723 GTGGGCAGGGGGTCATCTGGTGG + Intronic
1130255337 15:82323367-82323389 GAGGGCCGGAGGGAAACTGAGGG - Intergenic
1130599628 15:85266619-85266641 GAGGGCCGGAGGGAAACTGAGGG + Intergenic
1132691375 16:1183271-1183293 CTGTGCTGGGGGAAAACTGGGGG - Intronic
1132824820 16:1899063-1899085 GTGGCCAGGATCAGAACTGGAGG + Intergenic
1132838653 16:1967446-1967468 GAGGGCAGGAGTGAGACTGGGGG + Intronic
1132908335 16:2295778-2295800 GTGGGCATGAAGAGACCTGGGGG - Intronic
1133982032 16:10640105-10640127 GGGGGGAGGAGGAAGACGGGAGG - Intronic
1134025504 16:10949909-10949931 ATGGGCAGGAGGAAAAGAGCAGG - Intronic
1134446674 16:14336466-14336488 GTGGGAGAGAGGGAAACTGGAGG - Intergenic
1134449361 16:14354113-14354135 GAGGGAAGGAGGAAAAGAGGGGG + Intergenic
1134520620 16:14917848-14917870 GAGGGCAGAAGGGATACTGGGGG - Intronic
1134550954 16:15138126-15138148 GAGGGCAGAAGGGATACTGGGGG + Intronic
1134702333 16:16275591-16275613 AGGGGCAGGAGGAAACCTTGAGG - Intronic
1134708292 16:16316499-16316521 GAGGGCAGAAGGGATACTGGGGG - Intergenic
1134715507 16:16356532-16356554 GAGGGCAGAAGGGATACTGGGGG - Intergenic
1134951310 16:18352146-18352168 GAGGGCAGAAGGGATACTGGGGG + Intergenic
1134959250 16:18395627-18395649 GAGGGCAGAAGGGATACTGGGGG + Intergenic
1134969497 16:18519059-18519081 AGGGGCAGGAGGAAACCTTGAGG + Intronic
1135398586 16:22149764-22149786 CTGGGGAGGAGGAAAAGAGGAGG - Intronic
1135733902 16:24915784-24915806 GTGGGCAGGAGGGAAACTAAGGG + Intergenic
1136240293 16:28939087-28939109 GTGGGCAGGGGGAGGACTGCTGG + Intronic
1136673814 16:31880941-31880963 GTGGTCAGGAGCAAGAATGGAGG + Intronic
1137263712 16:46851901-46851923 GAGGGCAGGAGGAGAAGTGGGGG - Intergenic
1137364374 16:47848116-47848138 GTGGGCAGGTGGTAACCAGGAGG + Intergenic
1138045543 16:53720404-53720426 GTGGGGAGGGGGAGAAGTGGTGG - Intronic
1138053018 16:53801990-53802012 GTGGGCGGGTGGATAACTTGAGG - Intronic
1139160976 16:64508086-64508108 GTGGGAATGTGGAACACTGGGGG + Intergenic
1139484237 16:67247144-67247166 GTGGGCGCCATGAAAACTGGTGG - Intronic
1140035424 16:71367939-71367961 AAAGGAAGGAGGAAAACTGGAGG - Intronic
1140130382 16:72155823-72155845 ATGGGCATGAGGAAACGTGGGGG - Intronic
1140880818 16:79196648-79196670 GTGTACAGGATGAGAACTGGAGG - Intronic
1141256675 16:82408887-82408909 CAGGGTAGGAGGAACACTGGTGG + Intergenic
1141694853 16:85614409-85614431 GAGGGGAGGCGGAAAGCTGGGGG - Intronic
1142228674 16:88889315-88889337 GAGGGCAGGAGGAAAGGAGGGGG + Intronic
1143944214 17:10575546-10575568 CAGGGCAGGAGGATCACTGGAGG + Intergenic
1143958523 17:10695364-10695386 CTGGGCAAGATGAAATCTGGAGG - Intronic
1144077074 17:11729135-11729157 CTGAGCAGTAGGAAAACTGGTGG + Intronic
1145843077 17:28012817-28012839 GTGGGAAAGAAGAGAACTGGTGG - Intergenic
1146100383 17:29974957-29974979 GAGGGCAGGAGGATTACTTGAGG + Intronic
1147274673 17:39305615-39305637 GAGGGCAGGAGGATAACTTGAGG + Intronic
1147279937 17:39350864-39350886 GTGGGCAGGAGAGAAAATGGTGG + Intronic
1147617837 17:41840704-41840726 GTGGGCAGCATGAAAACAAGAGG + Intronic
1148138605 17:45312000-45312022 GGGGGCAGGAGGTAAACAGGAGG - Intronic
1148274479 17:46291369-46291391 GTGAGCAGGACTAAAACTGCAGG + Intronic
1148845524 17:50527681-50527703 GAGGGCAGGAAGAAGACGGGGGG + Intronic
1148892832 17:50820235-50820257 GTCAGCAGAAGGAAAACAGGAGG - Intergenic
1149513044 17:57258117-57258139 GTAGGCAGGAGGGGAATTGGAGG + Intronic
1150408576 17:64923186-64923208 GTGAGCAGGACTAAAACTGCAGG - Intergenic
1150701911 17:67454528-67454550 ATGGGCAGTATGAAAACGGGTGG + Intronic
1150760211 17:67954589-67954611 GTGAGCAGGACTAAAACTGCAGG - Intronic
1151109204 17:71655000-71655022 CAAGGCAGGAGGATAACTGGAGG - Intergenic
1151445186 17:74159117-74159139 GTGGGCAGGGGGAGCACTGGGGG - Intergenic
1151472596 17:74327177-74327199 GTGGGCAGTAAGGTAACTGGAGG + Intronic
1151571974 17:74930997-74931019 GTGGGCAGGCGGACAACGTGTGG - Exonic
1152032351 17:77851772-77851794 GTGGGCAGGAGGATGGCGGGAGG - Intergenic
1152266262 17:79296792-79296814 GTGGGGAGGAGGAAAAGAGGAGG - Intronic
1152324012 17:79625116-79625138 CAGGGCAGGAGGAAACCTTGGGG - Intergenic
1153502930 18:5767440-5767462 ATTGGCATGAGGAAAGCTGGTGG + Intergenic
1153707625 18:7762386-7762408 ATGGGCAGGAGGATCATTGGGGG + Intronic
1154132721 18:11750771-11750793 GTGGGCAGGAGGAAAACTGGTGG + Intronic
1155246257 18:23913016-23913038 GTGGGCAGGGAGGAAGCTGGAGG - Intronic
1155257718 18:24013989-24014011 TGGGGCAGGAGGAGAAATGGAGG - Intronic
1155917784 18:31572991-31573013 GAGGGAAGGAGGGAAAGTGGGGG + Intergenic
1156829182 18:41469793-41469815 GGGGCCAGGAAGAAAACTGAGGG + Intergenic
1157129149 18:44987276-44987298 GTGGTCAGCAGGAAAACTCTGGG - Intronic
1157358966 18:46961300-46961322 GTGGGTAGCAGGAGAAGTGGTGG + Intronic
1157604590 18:48917859-48917881 GTGGTCAGGAGGAAACGTGGCGG + Intergenic
1158319653 18:56248895-56248917 GGGGGCAGGGGGAAGAGTGGGGG + Intergenic
1158406677 18:57165951-57165973 ACATGCAGGAGGAAAACTGGTGG + Intergenic
1158774442 18:60560438-60560460 GTGGGAAGGATGAATGCTGGCGG - Intergenic
1158866323 18:61640942-61640964 GTGGGCAGGAGGGAAACCACTGG - Intergenic
1158866657 18:61644113-61644135 GTGGGCAGGAGGAAAACCACTGG - Intergenic
1159035929 18:63277029-63277051 GTGGGAGGGAGGGAAAGTGGCGG - Intronic
1159957186 18:74527093-74527115 GTGGGAAGGAGGAAAAGAGAGGG + Intergenic
1160468417 18:79103545-79103567 TTTGGCATGAGGAAAACTAGGGG + Intronic
1160600446 18:80008635-80008657 GTGGGGTGGAGGAGAACGGGGGG - Intronic
1161559033 19:4960595-4960617 GTGGCCAGGAGCAAACCTGATGG + Intronic
1162757040 19:12866726-12866748 GAGAGCAGGAAGAGAACTGGCGG - Exonic
1163581073 19:18139088-18139110 GGGAGCAGGAGGAGAACTGGGGG - Exonic
1164399705 19:27894163-27894185 GTTTTCAGGTGGAAAACTGGAGG - Intergenic
1164513902 19:28918151-28918173 GTGGGCAGGAGGAACAGCGCTGG + Intergenic
1165086263 19:33350001-33350023 CTGGGCAGGAGGATCACTTGTGG + Intergenic
1165161916 19:33821256-33821278 GTGGAGAGGAGGCAAACTAGAGG - Intergenic
1165434294 19:35787990-35788012 GTGGTCAGGGGGAAAGCAGGAGG - Exonic
1165434331 19:35788119-35788141 GTGGGCAGGAGGGGAAGAGGAGG - Exonic
1165789481 19:38483051-38483073 GTGGGCAGGACGAAGACGGCAGG - Exonic
1166561354 19:43734339-43734361 GTGGGCAGGAGGAAAAATGAGGG - Intronic
1167436450 19:49481266-49481288 GTGGACAGGGGGGAACCTGGGGG + Intronic
1167877596 19:52427245-52427267 GTAGACAGAAGGAAAACTTGAGG + Intergenic
925208357 2:2026364-2026386 GTGCCCAGGAGGGAGACTGGAGG + Intronic
925657295 2:6164074-6164096 CTGCGCAGCAGGAGAACTGGAGG - Intergenic
925738687 2:6986284-6986306 GTAGGGAGGAGGAAATCGGGTGG - Intronic
925840371 2:7986268-7986290 GTGTGGAGGAAGAAAACTGATGG + Intergenic
926336333 2:11865502-11865524 GGGGGCAGGAGGAAATGTGTTGG + Intergenic
926347589 2:11962581-11962603 GTTGGCAGGAGGAAAAAGGGAGG - Intergenic
926406889 2:12562825-12562847 GGAGGCAGGAGGAAAACTGATGG + Intergenic
926980561 2:18562580-18562602 GAGGGTAGGAGGAAAAGAGGAGG + Intronic
928039005 2:27854901-27854923 ATGGGCAGGAGGAAACTTGGAGG - Intronic
928340566 2:30439788-30439810 GTGGGGAGGAGGAAAACGGAGGG - Intergenic
928927063 2:36590702-36590724 GTGTGCTGGAGAAGAACTGGAGG + Intronic
929184682 2:39081285-39081307 GTGGGCTGGCGGATCACTGGAGG + Intronic
930105390 2:47635108-47635130 GTGGGCAGGAGGACAACAGGAGG - Intergenic
931400119 2:61924277-61924299 GTGGACAGGAGAAAAATAGGAGG + Intronic
932581377 2:72994679-72994701 GTGGGCTGGAGGAGAAGGGGTGG - Intronic
932694178 2:73940227-73940249 ATAGCCTGGAGGAAAACTGGAGG - Intronic
932696492 2:73961193-73961215 GTTGGCAGCAGGGAAACTTGGGG - Intergenic
933418576 2:82020070-82020092 GGGGGGAGGGGGAAATCTGGAGG + Intergenic
933802846 2:85976793-85976815 GTGGGAAGGAGAGAACCTGGCGG - Intergenic
935309179 2:101766279-101766301 CTGGACAGGAGGTAAGCTGGTGG + Intronic
935461326 2:103338369-103338391 GGGGGAAGGAGGATAAATGGGGG + Intergenic
937126825 2:119480337-119480359 GTGGGCAGGAGGACACATGCAGG + Intronic
937241363 2:120464641-120464663 CTCGGCAGGAAGAAAACTGAAGG - Intergenic
938170289 2:129069871-129069893 GTGGGCAGCACCAAACCTGGTGG + Intergenic
939017543 2:136919934-136919956 GTGGGCAGCAGGGAACATGGTGG + Intronic
939965524 2:148606790-148606812 GTGCCCAGGAGGAAAATTTGAGG - Intergenic
940207200 2:151216256-151216278 CAAGGCAGGTGGAAAACTGGAGG + Intergenic
940285108 2:152026248-152026270 GAGGGAAGGAGGAAAATTGCTGG - Intronic
940404900 2:153289747-153289769 GTGGGAAGGAGCTAAACTGCAGG + Intergenic
940945588 2:159615020-159615042 GAGGGCAGGAAAAAAAATGGAGG + Intronic
942552710 2:177135965-177135987 GTGGGCAGTATGAAAACAGGTGG - Intergenic
943593498 2:189827849-189827871 GGGAGAAGGAGGAAAACTGGAGG + Intronic
944770805 2:202912471-202912493 GGAGGCAGGAGGAAGACGGGGGG - Intronic
945750925 2:213781424-213781446 GAAGGCAGGAAGAAACCTGGGGG - Intronic
946137102 2:217656437-217656459 GTGGGCGGCAGGCAAACTTGGGG - Intronic
946159353 2:217826662-217826684 GAGGGAAGGAGGAAAACAGCAGG - Intronic
946650095 2:221883989-221884011 GGGGGCAGTGGGGAAACTGGTGG - Intergenic
947918312 2:233848897-233848919 GACAGAAGGAGGAAAACTGGAGG + Intronic
947956642 2:234197692-234197714 GGAGACAGGAGGAAAACAGGAGG + Intergenic
947996084 2:234529087-234529109 GTGTGAAGGGGGAAAACTGTTGG + Intergenic
948049581 2:234969455-234969477 ATGGGCAGGAGGAACAAGGGTGG - Intronic
948962777 2:241354504-241354526 GTGGGCAGGAAGAAGGCTAGAGG - Intergenic
1169391977 20:5198039-5198061 AAGGGCAGGAGGAAAGCCGGGGG - Intergenic
1170701941 20:18711809-18711831 GTGAGCAGGAGGATCACTTGGGG + Intronic
1170787882 20:19483217-19483239 GTGGGTAGGAGGAAAACTATTGG - Intronic
1171036072 20:21713954-21713976 GTGGGCAGGGGGAAATCTTGCGG - Intronic
1171290937 20:23982455-23982477 CTGGGCAGCAGGAACAGTGGGGG + Intergenic
1171408220 20:24928158-24928180 GTGGTCAGGATGAAAGTTGGGGG + Intergenic
1172166037 20:32899976-32899998 AGGGGCCGGAGGAAAACTGCAGG - Intronic
1172607015 20:36220821-36220843 GTGGCCAGGAGGAAGGCAGGAGG + Intronic
1173856964 20:46256514-46256536 GTGGGAAGGAGGAACATCGGGGG + Intronic
1174022450 20:47541613-47541635 GAGGGCAGGAGGGTAACTTGAGG - Intronic
1174392506 20:50226631-50226653 GTGGGCGGGGGGAGAACTGGAGG - Intergenic
1174589090 20:51630967-51630989 TTGGGCGGCAGGAAAACAGGTGG - Intronic
1175442789 20:59002844-59002866 GCGGGGAGAAGGAAAGCTGGAGG - Intronic
1175480005 20:59304048-59304070 GAGGGCAGGAGGAAGTTTGGAGG - Intronic
1175691298 20:61067719-61067741 GTGAGCAGCAGTAGAACTGGGGG - Intergenic
1175789913 20:61734778-61734800 GTGGGGACGGAGAAAACTGGCGG - Intronic
1176263900 20:64198568-64198590 GTTGGCAGGTGCAAACCTGGGGG + Intronic
1178379504 21:32096151-32096173 GTTGGCAGGAGGAAGACCAGAGG - Intergenic
1178961844 21:37073044-37073066 GTGGGGAAGAGGAAAACCTGAGG + Intronic
1178997020 21:37411827-37411849 ATGTGCAGGAAAAAAACTGGTGG - Intronic
1179043910 21:37828878-37828900 GTGGCCAAGAGAAAAGCTGGAGG - Intronic
1179128325 21:38611918-38611940 CTGGGCAGGAGGAAAAAAAGCGG + Intronic
1179798630 21:43799962-43799984 GGGGGCCGCAGGAAATCTGGGGG - Intronic
1179928493 21:44551465-44551487 GTGGGGAGGAGGTGAGCTGGGGG + Exonic
1179929654 21:44558722-44558744 GTGGGGAGGAGGTGAGCTGGGGG + Exonic
1179939150 21:44627143-44627165 GTGGGGAGGAGGTGAGCTGGGGG - Exonic
1179941997 21:44646430-44646452 GTGGGGAGGAGGTGAGCTGGGGG - Exonic
1180059741 21:45378748-45378770 GAGGGCAGGGGGAGAACTGCGGG - Intergenic
1180094521 21:45549788-45549810 GTGGGGAGGAGGACAGGTGGGGG + Intergenic
1181393723 22:22603163-22603185 GTGGCCAGCAGGACACCTGGAGG + Intergenic
1182297143 22:29316275-29316297 GTGGGCAGGAGGAAGGTAGGAGG - Intronic
1182856454 22:33521654-33521676 GTAGGCAGGGGAAAAACTTGTGG + Intronic
1183386584 22:37518800-37518822 GTGGGGAGGAGGCAGGCTGGTGG + Intronic
1183390306 22:37541952-37541974 GTGGGGAGGAGGAAAGCAGAGGG - Intergenic
1183467248 22:37985974-37985996 GTGGCGTCGAGGAAAACTGGGGG - Intronic
1183537996 22:38414197-38414219 GCGGGCAGGTGGAAAGCTGGAGG - Intergenic
1184172338 22:42767218-42767240 GTGGGCATGAGCAAAACGAGGGG - Intergenic
1184326630 22:43792636-43792658 GTGGGAAGAAGAATAACTGGGGG - Intronic
1184711247 22:46250636-46250658 GAGGGCAGGTGGGAGACTGGAGG - Exonic
949485238 3:4531755-4531777 GTGGGCATTAGAAAGACTGGGGG - Intronic
950195349 3:11005610-11005632 GTGATGAGGAGGAAAACAGGAGG - Intronic
950566184 3:13771028-13771050 GTGAGCAGGAGGGAGACTGGAGG - Intergenic
950788895 3:15456625-15456647 GGGGGCAGGAAAAAAGCTGGAGG + Intronic
952101664 3:30020377-30020399 ATGGGGAGGAGGAAAGTTGGAGG - Intergenic
953552970 3:43918683-43918705 CTGGGCAGGAGGAAAAACGAAGG - Intergenic
954214240 3:49115687-49115709 GTGGGAAGGACGAAGAATGGAGG - Intronic
954410063 3:50366658-50366680 ATGGGAGGGAGGAAAACTGGTGG - Intronic
955708727 3:61755949-61755971 GAGGGCAGGATGAAAAATGATGG + Intronic
955774269 3:62416723-62416745 ATTGGTAGGAGGAAAACTGGAGG + Intronic
956988020 3:74726533-74726555 GTCGGAAGGAGGAAAAGTTGTGG - Intergenic
958414875 3:93861879-93861901 GTTGGCATGAGGGAAAATGGAGG + Intergenic
958463173 3:94424872-94424894 GTCAGCAGGAGGAAACCTGGGGG + Intergenic
958767149 3:98382818-98382840 GTGGGCTGGAGGAAAAAGAGAGG - Intergenic
960089846 3:113628073-113628095 CTGGGCAGGGTGACAACTGGAGG - Exonic
961144701 3:124584499-124584521 GTGGGCACGGGGCAAACGGGTGG - Intronic
961752346 3:129104280-129104302 GTGTGCAGGAGGAGAGCTTGGGG - Intronic
963761317 3:149289309-149289331 GCTGGCAGTAGGAAAAATGGAGG + Intergenic
965016131 3:163159762-163159784 GAGGGAAAGAGGAAAACTGGAGG - Intergenic
967064425 3:185902286-185902308 GCTGGGAGGAGGAAAACTGTGGG - Intergenic
967975804 3:195034322-195034344 GTGTGCTGAAGGAACACTGGTGG - Intergenic
968502427 4:957141-957163 GGGGGCAGGAGACAGACTGGAGG - Intronic
968651476 4:1761869-1761891 GTGGGCAGGAGGCCCGCTGGGGG - Intergenic
969588658 4:8108967-8108989 GTGGGAAAGATGAAAGCTGGTGG + Intronic
971183358 4:24350895-24350917 GGGGGCAGGAGGATCACTTGAGG + Intergenic
971769591 4:30879151-30879173 GAGGGAGGGAGGAAAACAGGAGG - Intronic
972929555 4:44054934-44054956 GTGGGGAGGGGGAAAGATGGAGG - Intergenic
973610969 4:52635749-52635771 GTGAGGAGGAGGGTAACTGGAGG - Intronic
975366792 4:73539049-73539071 ATGGGCAGGAGGCAAAGTGAGGG - Intergenic
975924268 4:79430188-79430210 GAGGGCTGGAGGAAAGATGGAGG - Intergenic
976068076 4:81212879-81212901 GTGAGTAGGAGGAACACTGCAGG + Intronic
976161997 4:82211381-82211403 GGGGTCAGGAGGAGACCTGGAGG - Intergenic
976692715 4:87885875-87885897 GAGGGAAGGAGGAAAGCTCGGGG + Intergenic
976822908 4:89227064-89227086 GTTGGCAGGAGGGAGAGTGGAGG + Intergenic
977074365 4:92433751-92433773 GTGGGGAGGATGAATACTGAAGG + Intronic
978528923 4:109694805-109694827 TTGGGGAGGAGGAAAATTTGTGG + Intronic
979213739 4:118137742-118137764 ATGGGCAATAGGAAAACAGGTGG + Intronic
979244267 4:118481627-118481649 ATGGGCATGAAGAAAACTGCTGG - Intergenic
981208689 4:142074946-142074968 GTGGCCAGGAGGTATCCTGGAGG - Intronic
981898652 4:149835472-149835494 GTGGGCGGGAGGAAGGCGGGAGG - Intergenic
982625060 4:157756257-157756279 CTGGGCAAGAGCAAAGCTGGAGG - Intergenic
983443589 4:167819897-167819919 GGCAACAGGAGGAAAACTGGTGG - Intergenic
985268822 4:188175548-188175570 GGAGGCAGGAGGAACACAGGAGG + Intergenic
985383444 4:189420091-189420113 GTGTGCAGAAGAGAAACTGGCGG - Intergenic
985537303 5:472578-472600 GCGGGCAGGACGGAACCTGGGGG + Intronic
985946725 5:3191018-3191040 GTGGGCAGGAGGAAGAACTGAGG - Intergenic
986731575 5:10638417-10638439 GTGGGCAGGAGGAAAACAGCAGG - Intronic
987083406 5:14446491-14446513 GTGGGCAGGGGGAAGAGAGGGGG + Intronic
987336939 5:16905409-16905431 GAGGGCAGGGGGACAGCTGGAGG + Intronic
987368479 5:17171384-17171406 GGAGGCAGGAGGAACACTTGAGG + Intronic
988180551 5:27786341-27786363 CTGGGCAGGAGAAAAAATGGTGG + Intergenic
990365796 5:55069150-55069172 GTGGCCATGAGGAAAAGAGGTGG + Intergenic
990486755 5:56266891-56266913 CTGGGCAGGAGGATCACTTGAGG - Intergenic
992105110 5:73444018-73444040 GTTGGGAGGAGGAGAGCTGGTGG + Intergenic
993312921 5:86359520-86359542 GTGGGCATGAGAAATACTGAGGG - Intergenic
993537273 5:89102534-89102556 GTGGTCATGAGGAAGACTGCTGG + Intergenic
993540037 5:89137944-89137966 GTGGGCAGGAGGATTACAGCTGG + Intergenic
994044769 5:95295548-95295570 GTGGGCAGGTGGATCACTTGAGG - Intergenic
994287437 5:97986385-97986407 GTAGGGAGGATGAAAAGTGGAGG - Intergenic
995226617 5:109708144-109708166 GTTGGCAGGAGGAAAACCTAGGG + Intronic
997406610 5:133654018-133654040 CTGGGCAGGAAGAAAACTCTAGG + Intergenic
999252554 5:150191055-150191077 ATGGGGAGGGGGAATACTGGGGG + Intronic
1000183326 5:158834387-158834409 GTGGGTATGAGGAAGGCTGGAGG - Intronic
1000209580 5:159097444-159097466 GTGGGGAGGAAGAAAAGTGGCGG + Intronic
1001742820 5:174067946-174067968 GTGGGGAGGGGGAAGACAGGTGG + Intronic
1001895643 5:175377723-175377745 GGAGGCAGGAGGAAGACTGTAGG - Intergenic
1002498933 5:179634713-179634735 CTGGGCAGAAGGAAAACTAGGGG - Intronic
1002502743 5:179657811-179657833 CTGGGCAGAAGGAAAACTAGGGG + Intergenic
1002562784 5:180093570-180093592 GGAGGCAGGAGGATAACTTGAGG - Intergenic
1002643834 5:180643439-180643461 GAGGGGAGGAGGGAAAGTGGAGG - Intronic
1003390364 6:5708065-5708087 GTGGGTAGGATGAAAACATGTGG + Intronic
1003750934 6:9055035-9055057 GAGGACAGTAGGAAAACTGCTGG + Intergenic
1003778742 6:9398893-9398915 GTGGGGAGGCTGAGAACTGGCGG + Intergenic
1004605958 6:17195257-17195279 TGGGGCAGGAGGAACACTTGAGG - Intergenic
1004990429 6:21130957-21130979 TGGTGCAGAAGGAAAACTGGGGG - Intronic
1005077847 6:21926081-21926103 TTTGGAAGGAGGAAAACAGGAGG - Intergenic
1005579974 6:27224467-27224489 GTGGAGAGAAGGCAAACTGGTGG + Intergenic
1006819975 6:36885517-36885539 GTGGGCTGAGTGAAAACTGGAGG + Intronic
1007255158 6:40523278-40523300 GTCTGCAAGAGCAAAACTGGAGG - Intronic
1007407280 6:41642345-41642367 GTGGGCAGGAGGCAAGGGGGTGG - Intronic
1008740776 6:54605346-54605368 GGGGGCTGGAGGGAAACGGGAGG - Intergenic
1011495846 6:87936089-87936111 GTGGGGAGGAGAGAAACTGGGGG + Intergenic
1011574502 6:88780839-88780861 GTGGACAGGAAGCTAACTGGAGG + Intronic
1012767228 6:103383517-103383539 GTGGGCAGGAGGGAATAGGGAGG + Intergenic
1013394627 6:109722871-109722893 GTGGGGATGAGAAAAGCTGGTGG + Intronic
1013419069 6:109949800-109949822 ATGGGCAGGAGGAGGACTGCAGG + Intergenic
1013519088 6:110916131-110916153 GAGGCCAGGAGGAACACTTGCGG + Intergenic
1014794577 6:125710082-125710104 GTGGGGAGGAGGATCAGTGGAGG - Intergenic
1016382692 6:143500858-143500880 GTGGGCATGATGAACCCTGGGGG + Intronic
1016547285 6:145238736-145238758 CTGGAAAGGAGGAAGACTGGGGG - Intergenic
1018374298 6:163196070-163196092 GTGGGCAGGAGATGAGCTGGAGG - Intronic
1018635785 6:165858268-165858290 GAGGGCCTGAGGAAAGCTGGAGG - Intronic
1019397131 7:827252-827274 GCGGGCAGGAGGATCACTTGAGG - Intronic
1019424045 7:964801-964823 TTGGGCATGAGGTAAACCGGAGG - Intronic
1019660317 7:2220334-2220356 GTGGTCAGGAGGAAGCCTGGCGG - Intronic
1020035281 7:4959953-4959975 GTGGGAAGAAGGGGAACTGGAGG + Intergenic
1022394672 7:29976141-29976163 TTGGTCTGAAGGAAAACTGGTGG - Intronic
1022437842 7:30407185-30407207 GTGAGCAGGTGGGAAGCTGGGGG + Intronic
1023055539 7:36287007-36287029 GAGGGCAGGAGGATCACTTGAGG + Intronic
1023576619 7:41635100-41635122 GTGGGCAGCAGGCATACTGGCGG + Intergenic
1023780987 7:43655233-43655255 CTTGGCAGGAGGATTACTGGAGG - Intronic
1023834033 7:44058145-44058167 GTCGGCTGGAGGAAAAGCGGCGG + Exonic
1023896052 7:44433894-44433916 GGGAGCAGGAGGAAAAAGGGAGG - Intronic
1024369627 7:48565947-48565969 AAGGGCAGGTGGTAAACTGGGGG + Intronic
1024936835 7:54719490-54719512 GTGGCCAGGAGGAAATCAGTTGG - Intergenic
1025011915 7:55404269-55404291 GTGGGCAGGAAGAAAGGTAGAGG - Intronic
1026035022 7:66824562-66824584 GGTGGCAGGAGGAACACTCGGGG - Intergenic
1026656962 7:72265052-72265074 TGAGGCAGGAGGATAACTGGAGG - Intronic
1026897987 7:74021621-74021643 GTGGGCAGGAGGACAAAGGCTGG + Intergenic
1027789692 7:82623715-82623737 GTGGACAAAAGGAAAACTTGAGG + Intergenic
1028491160 7:91413831-91413853 GAGGGAATGAGGAATACTGGAGG - Intergenic
1030065519 7:105656072-105656094 GTGGGCAGGAGGCAGAGAGGAGG - Intronic
1030148589 7:106380535-106380557 ATGGGCAAGAGAAAAACTGGAGG + Intergenic
1030513916 7:110518499-110518521 GTGGGCCTGAGCAAAACTTGAGG - Intergenic
1030645973 7:112062211-112062233 GTTGGTGGGAGGAAAAGTGGTGG - Intronic
1031937663 7:127752257-127752279 GTGAGCAGGTGGAAATTTGGAGG + Intronic
1033088383 7:138363105-138363127 GTGGGAAGGGGGAAAAAAGGTGG - Intergenic
1033266067 7:139888277-139888299 GTGGGAAAGAGGAAACTTGGAGG - Intronic
1033682058 7:143604431-143604453 GAGGCCAGGAGGCAAAATGGAGG + Intergenic
1033702831 7:143857482-143857504 GAGGCCAGGAGGCAAAATGGAGG - Intronic
1034250998 7:149690714-149690736 GGAGGCAGGAGGAAGACTGGAGG + Intergenic
1034263321 7:149770379-149770401 GAGGGCAGGAGGAAAGCAGGGGG + Intronic
1034272722 7:149811196-149811218 GTGGGGAGAGGGAAAACAGGTGG - Intergenic
1034636643 7:152572565-152572587 ATGGGGAGGAGGAAAGCGGGAGG - Intergenic
1034989447 7:155538787-155538809 GTGGGCAGGAGGTGAATAGGAGG - Intergenic
1034995125 7:155572138-155572160 GAGGGAAGGAGGAAAGATGGAGG + Intergenic
1035022204 7:155806488-155806510 GTGGCCAGGAGTGAAACTGCGGG - Exonic
1035290739 7:157837112-157837134 GTGGGCAGGTGGACAGGTGGTGG - Intronic
1035365237 7:158345034-158345056 GTGGGCGGGAGAAATTCTGGAGG + Intronic
1035564808 8:634621-634643 GTGCGCAGAAGGACAGCTGGCGG + Intronic
1035565438 8:637709-637731 GGGAGCAGGAGGAAAGCTGGGGG + Intronic
1037003752 8:13751345-13751367 GTGGCCAGGAGGAAAGATAGGGG - Intergenic
1037662585 8:20940444-20940466 GTGGGCAAGAGGAAAAAGGTGGG - Intergenic
1037755053 8:21705126-21705148 CTGGGCAGGAAGAAAGGTGGGGG + Intronic
1037937050 8:22921939-22921961 GTAGGGAGGAGGTAAACTGAGGG + Intronic
1038922500 8:32100112-32100134 GAGGGAAGGAGGAAAAGAGGGGG - Intronic
1039840267 8:41287983-41288005 ATAGGCAGGAGGATAACTTGAGG + Intronic
1040063918 8:43128441-43128463 GTGGGCAGGATATAATCTGGTGG + Intergenic
1040286685 8:46104021-46104043 GTGGGCAGGAGAAACGCAGGAGG - Intergenic
1041009304 8:53525640-53525662 GAGAGCAGCAGGAGAACTGGTGG + Intergenic
1041344126 8:56878282-56878304 GTGGGCAAGAGAAAAAGTTGGGG - Intergenic
1042572308 8:70178783-70178805 GTGGACAGCAAGAAAACAGGTGG + Intronic
1043427072 8:80158238-80158260 GTGGGGAGGAGGAGAATGGGAGG - Intronic
1044813789 8:96090017-96090039 GTGGGGAGGAGGAGAAGTGTGGG - Intergenic
1045211324 8:100103250-100103272 GTTGGCAGAAGGAATATTGGAGG + Intronic
1046757257 8:117984598-117984620 GAAGGCAGCAGGAAACCTGGGGG + Intronic
1047331325 8:123890348-123890370 CTGAGTAGGAGAAAAACTGGGGG + Intronic
1047467290 8:125129261-125129283 GAGGGTAGGAGGAAATCTAGAGG + Intronic
1047927338 8:129694515-129694537 GAAGGCAGGAGGACAGCTGGTGG - Intergenic
1048058702 8:130894807-130894829 GTGTAGAGCAGGAAAACTGGTGG + Intronic
1048878840 8:138857171-138857193 GTGGGGAGGTGGCAAGCTGGAGG - Intronic
1048879962 8:138864063-138864085 GTGGGATGAAGTAAAACTGGAGG - Intronic
1049305802 8:141903201-141903223 GTAGGCAGGAGACAAACTGCTGG + Intergenic
1049854899 8:144855266-144855288 GAGGGCAGTAGGAGAAGTGGTGG + Intergenic
1051498224 9:17748756-17748778 GTGGCGAGGAGGAAAACTAATGG + Intronic
1052259540 9:26497696-26497718 GAGGCCAGGGGGGAAACTGGAGG + Intergenic
1053121135 9:35548166-35548188 AAGGGCCGGAAGAAAACTGGAGG + Exonic
1056028555 9:82526353-82526375 GTGGTCAGGAGAGAAAGTGGAGG - Intergenic
1056688537 9:88786327-88786349 GTGGGCAGAGGGGAAACGGGTGG + Intergenic
1056992557 9:91424415-91424437 GTGGGCAGGAGGGAAGGCGGGGG + Intergenic
1057073842 9:92123914-92123936 GGGGGCAGTAGGAAAACCGGGGG + Intergenic
1057856207 9:98602710-98602732 GTGGGAGGGGAGAAAACTGGAGG + Intronic
1060462222 9:123867713-123867735 GGGAGCAGGGGGAGAACTGGGGG - Intronic
1060968566 9:127724947-127724969 GCGGGCAGGAGGCCAACTGCTGG + Intronic
1060969981 9:127732348-127732370 AGGGGCAGGAGGAAAAATGCTGG + Intronic
1061547541 9:131313420-131313442 GTGGGAAGGAAGAAACCAGGTGG - Intergenic
1061778835 9:132984208-132984230 GTGAGCAGGAGGAGGACTGGGGG - Intronic
1061875180 9:133539961-133539983 GTGGGCAGGTGGGGAAATGGAGG + Intronic
1062558446 9:137128085-137128107 GAGGCCAGCAGGAAAAGTGGTGG + Intergenic
1062726372 9:138076287-138076309 GGGCGCAGGTGGAAAGCTGGAGG - Intronic
1186200810 X:7153402-7153424 GAGGACAGGAGGAAGACAGGAGG - Intergenic
1186885501 X:13909354-13909376 GTGGGCAGGCGGATTACTTGAGG - Intronic
1187021412 X:15386699-15386721 GTATGCTGGAGGAATACTGGAGG + Intronic
1189180883 X:39003505-39003527 TGGGGCAGGAGGAAAACCAGGGG + Intergenic
1190592256 X:52016078-52016100 GTGGGCAGGAGGAAAAGGAAGGG - Intergenic
1191849945 X:65578742-65578764 GTGGGCAGAGGGAACAGTGGTGG + Intergenic
1192501783 X:71659240-71659262 GAGGGCGTGAGGGAAACTGGGGG - Intergenic
1193148482 X:78101759-78101781 GTGTGCAGGTGGATCACTGGGGG + Intronic
1193199848 X:78675806-78675828 GTAGTCTGCAGGAAAACTGGAGG + Intergenic
1193876551 X:86869005-86869027 TTGGGCAGGAGGAGTACTGCCGG + Intergenic
1195093788 X:101487434-101487456 GTGGGCTGGAGTATGACTGGGGG + Intronic
1195368629 X:104151145-104151167 GTGATAAGGAGGAAACCTGGGGG - Intronic
1195731758 X:107975544-107975566 CTGGGAAGGATAAAAACTGGAGG - Intergenic
1196361130 X:114860786-114860808 GTGGGCATGAGGAAACTTGATGG - Intronic
1196777907 X:119357561-119357583 GTGGGCAACAGGAAACCGGGAGG + Intergenic
1198006683 X:132501882-132501904 GTGTGAAGGAGGAAGACTGATGG - Intergenic
1198189570 X:134288658-134288680 GTGGGCACTAGGAAACATGGTGG - Intergenic
1198278808 X:135122210-135122232 GTGGCCAGGAGAAAACCTGCGGG - Intergenic
1198292152 X:135250306-135250328 GTGGCCAGGAGAAAACCTGCGGG + Intronic
1199065990 X:143418774-143418796 GTGGGCAGCAGAAAATCTGTAGG - Intergenic
1199118182 X:144017668-144017690 GTGGGAGGGAGGAAAAGTAGAGG - Intergenic
1199493985 X:148432756-148432778 GTTGGCAGGAGGAAATCAGTGGG - Intergenic
1200037396 X:153340926-153340948 CTCAGCAGGAAGAAAACTGGAGG - Intronic
1200057770 X:153470624-153470646 GTGGGCGGGAAGAACGCTGGAGG - Exonic
1202152166 Y:21853446-21853468 ATGGGCAGTAGGAAAAATGATGG + Intergenic