ID: 1154133012

View in Genome Browser
Species Human (GRCh38)
Location 18:11752023-11752045
Sequence CCCCGCCCAGCGGGTCCCCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 211}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154133012_1154133024 15 Left 1154133012 18:11752023-11752045 CCTCGGGGACCCGCTGGGCGGGG 0: 1
1: 0
2: 2
3: 27
4: 211
Right 1154133024 18:11752061-11752083 AGTGCGGGCGAAGGGACGTGGGG 0: 1
1: 0
2: 0
3: 8
4: 107
1154133012_1154133025 24 Left 1154133012 18:11752023-11752045 CCTCGGGGACCCGCTGGGCGGGG 0: 1
1: 0
2: 2
3: 27
4: 211
Right 1154133025 18:11752070-11752092 GAAGGGACGTGGGGCGAACCCGG 0: 1
1: 0
2: 0
3: 8
4: 107
1154133012_1154133027 26 Left 1154133012 18:11752023-11752045 CCTCGGGGACCCGCTGGGCGGGG 0: 1
1: 0
2: 2
3: 27
4: 211
Right 1154133027 18:11752072-11752094 AGGGACGTGGGGCGAACCCGGGG 0: 1
1: 0
2: 0
3: 6
4: 80
1154133012_1154133023 14 Left 1154133012 18:11752023-11752045 CCTCGGGGACCCGCTGGGCGGGG 0: 1
1: 0
2: 2
3: 27
4: 211
Right 1154133023 18:11752060-11752082 GAGTGCGGGCGAAGGGACGTGGG 0: 1
1: 0
2: 0
3: 5
4: 94
1154133012_1154133020 6 Left 1154133012 18:11752023-11752045 CCTCGGGGACCCGCTGGGCGGGG 0: 1
1: 0
2: 2
3: 27
4: 211
Right 1154133020 18:11752052-11752074 GAGGCTTGGAGTGCGGGCGAAGG 0: 1
1: 0
2: 0
3: 15
4: 204
1154133012_1154133019 0 Left 1154133012 18:11752023-11752045 CCTCGGGGACCCGCTGGGCGGGG 0: 1
1: 0
2: 2
3: 27
4: 211
Right 1154133019 18:11752046-11752068 CTGAGCGAGGCTTGGAGTGCGGG 0: 1
1: 0
2: 3
3: 14
4: 209
1154133012_1154133026 25 Left 1154133012 18:11752023-11752045 CCTCGGGGACCCGCTGGGCGGGG 0: 1
1: 0
2: 2
3: 27
4: 211
Right 1154133026 18:11752071-11752093 AAGGGACGTGGGGCGAACCCGGG 0: 1
1: 0
2: 0
3: 6
4: 101
1154133012_1154133021 7 Left 1154133012 18:11752023-11752045 CCTCGGGGACCCGCTGGGCGGGG 0: 1
1: 0
2: 2
3: 27
4: 211
Right 1154133021 18:11752053-11752075 AGGCTTGGAGTGCGGGCGAAGGG 0: 1
1: 0
2: 1
3: 9
4: 105
1154133012_1154133018 -1 Left 1154133012 18:11752023-11752045 CCTCGGGGACCCGCTGGGCGGGG 0: 1
1: 0
2: 2
3: 27
4: 211
Right 1154133018 18:11752045-11752067 GCTGAGCGAGGCTTGGAGTGCGG 0: 1
1: 0
2: 1
3: 34
4: 234
1154133012_1154133017 -8 Left 1154133012 18:11752023-11752045 CCTCGGGGACCCGCTGGGCGGGG 0: 1
1: 0
2: 2
3: 27
4: 211
Right 1154133017 18:11752038-11752060 GGGCGGGGCTGAGCGAGGCTTGG 0: 1
1: 0
2: 22
3: 164
4: 1282
1154133012_1154133022 13 Left 1154133012 18:11752023-11752045 CCTCGGGGACCCGCTGGGCGGGG 0: 1
1: 0
2: 2
3: 27
4: 211
Right 1154133022 18:11752059-11752081 GGAGTGCGGGCGAAGGGACGTGG 0: 1
1: 0
2: 1
3: 31
4: 248

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154133012 Original CRISPR CCCCGCCCAGCGGGTCCCCG AGG (reversed) Intronic
900289889 1:1919375-1919397 CCCCGCCCACCGGGCCCCGCTGG + Intergenic
900504470 1:3022439-3022461 CCTGGTGCAGCGGGTCCCCGAGG - Exonic
900526184 1:3129979-3130001 CCCAGCCCAGCTGGTCGCCTTGG - Intronic
900599546 1:3497189-3497211 CCCTGCCCAGCCGCTCCTCGGGG + Intronic
900677931 1:3900218-3900240 CCCCGGCCAACGCGTCCCGGCGG + Exonic
901083134 1:6594736-6594758 CCACGCCCAGCTGGTTCCTGAGG - Intronic
901138703 1:7014099-7014121 CCCCAGCCAGCCGGTCCCCTTGG - Intronic
902044232 1:13513374-13513396 CCGCATCCAGCGGATCCCCGAGG - Exonic
902642403 1:17775252-17775274 CCCTGCCCAGCTGGACCCCTGGG - Intronic
903652493 1:24930307-24930329 CCCCGCCCCGCGGGCCCCGGGGG - Intronic
905202409 1:36323421-36323443 CCCGGGCCGGTGGGTCCCCGCGG - Intronic
906059042 1:42936494-42936516 CCCTGCCCACTGGGTCCCCTGGG + Intronic
906263135 1:44407835-44407857 CCCCGCCCCGGGGGTCACCCGGG - Intronic
914900559 1:151709115-151709137 CCCATCCCTGCGGGACCCCGCGG + Intronic
915012190 1:152698119-152698141 CCCCCCCAGGCTGGTCCCCGTGG - Intergenic
915345427 1:155194745-155194767 CCCCGCCCAGCGCCTGCCCCAGG - Intergenic
915571250 1:156746558-156746580 CCCCGCCCCACGTGTCCCCGTGG + Intronic
915901996 1:159854400-159854422 CCCCACCCACCCGGCCCCCGGGG + Exonic
921155031 1:212432841-212432863 CCGCGCCCAGAGCCTCCCCGAGG - Intergenic
922460821 1:225813294-225813316 CCCAGCCCAGCTGGCCCCCTGGG + Intronic
924242893 1:242057301-242057323 CCCAGGCCACCGGGTCCCTGAGG - Intergenic
924802222 1:247335759-247335781 CCCTGCCCTCCGGCTCCCCGTGG - Intergenic
1063114484 10:3064224-3064246 CCCCTCCCAGTGGCTCCCCGTGG + Intergenic
1063393686 10:5666604-5666626 CCCCGCCCAGCGGCCCCGCGCGG - Intergenic
1067776230 10:49166815-49166837 CCCCACCCAGCGAGGCACCGAGG - Intronic
1070610148 10:77927040-77927062 CCCGGCTCACCGGGGCCCCGCGG + Intergenic
1070923800 10:80205229-80205251 CCCAGCCCAGCGCGGCCCTGCGG - Intronic
1070947918 10:80408556-80408578 CCCGGCCCGGAGGGTCCCAGGGG - Exonic
1071600704 10:86957496-86957518 CCCAGCCCAGGGGGCCCCCAAGG + Exonic
1072654292 10:97319635-97319657 CCTCGCCGTGCGGGCCCCCGGGG + Exonic
1074586013 10:114768257-114768279 CCGCGCCCGGCGGGTCCCTGCGG - Intergenic
1074772193 10:116741826-116741848 CCCAGCCCAGTGAGTCCCTGGGG + Intronic
1075075358 10:119346743-119346765 CCCTGCTCACCGGGTCCCCCAGG + Intronic
1076370069 10:129946947-129946969 CCCCGGCCAGCGAGGCCCCAGGG - Intronic
1076384440 10:130046342-130046364 CCCCGCCCAGCGCCTCCCCCGGG + Intergenic
1076726852 10:132417995-132418017 CCCCGCCCAGCAGTGCCCAGGGG - Intergenic
1076750076 10:132538022-132538044 CCCCGGCCGGCCGGTCCCGGAGG + Exonic
1078334158 11:10450833-10450855 CCCCGGCCAGGAGGGCCCCGCGG - Exonic
1081195185 11:40152339-40152361 ACCCTCCCAGTGGATCCCCGTGG - Intronic
1081672413 11:44949638-44949660 CCCCGCCCAGCGGGGCGCGCCGG + Intronic
1083622785 11:64057208-64057230 CCCAGCCAAGCTGGTCCCAGAGG - Intronic
1083721596 11:64606355-64606377 CCGCGCCCAGCGGGTGCCACAGG + Exonic
1084480261 11:69415936-69415958 CGCAGCCCAGCGGGTCCCTGAGG + Intergenic
1084575457 11:69985708-69985730 CCCCGCGCAGCGGGAGGCCGGGG + Intergenic
1084888124 11:72223834-72223856 CCCCGCCCCGCGCCGCCCCGGGG - Intronic
1085197977 11:74683667-74683689 CCCCGCCTCTCGGATCCCCGCGG + Intergenic
1088588359 11:111379503-111379525 CCACACACAGCAGGTCCCCGCGG - Exonic
1090486348 11:127115954-127115976 CCCCGCCTAGCTGGGCCCTGTGG + Intergenic
1090830240 11:130416126-130416148 CCCCGCCCTACTTGTCCCCGTGG - Intronic
1091829728 12:3540937-3540959 CCCCTCCCAGAGGGGCCCCCCGG - Intronic
1096622659 12:52874244-52874266 CCCCGCCCCGCCGCGCCCCGCGG - Intergenic
1097794031 12:63843873-63843895 CCCCGCCTGGCGGAGCCCCGAGG + Intergenic
1100309039 12:93377768-93377790 CCCCGCCCACCGGGCGGCCGAGG + Intergenic
1102490651 12:113287937-113287959 CCCCGCCCAGCCGGTGTCCTGGG + Intronic
1103899319 12:124295261-124295283 CCCCGCGCCCCGGATCCCCGCGG - Intronic
1105472093 13:20703792-20703814 CGCCGCCCGCGGGGTCCCCGGGG - Intronic
1105606712 13:21932102-21932124 CCCCCACCACTGGGTCCCCGGGG - Intergenic
1107516250 13:41132459-41132481 CGCCGCCTAGCCAGTCCCCGTGG - Exonic
1111951440 13:94712128-94712150 GCCGGCCGAGCGGGTCTCCGCGG - Exonic
1114454835 14:22847664-22847686 CCCCGCCCTGCAGGTTCCTGGGG - Exonic
1116049110 14:39781615-39781637 GCCCTCCCAGTGGATCCCCGTGG + Intergenic
1118797170 14:69153505-69153527 AGCCGGCCCGCGGGTCCCCGCGG - Intergenic
1119046118 14:71320522-71320544 CCCCGGCTGGAGGGTCCCCGGGG + Intronic
1119764958 14:77182257-77182279 CCCCACCCAGGGATTCCCCGGGG + Intronic
1122065830 14:99174037-99174059 CCGCACCCCGCGTGTCCCCGGGG - Exonic
1122097419 14:99381841-99381863 ACCCGCGCAGCGGCTCCCCAGGG + Intergenic
1122552023 14:102555443-102555465 TCCCGCCCTACGGGTCCCGGGGG + Intergenic
1122774789 14:104112304-104112326 CCCAGCCTAGGGGGTCCCGGTGG - Intronic
1122781073 14:104143796-104143818 CCCCACCCTGCGGATCCCCGAGG - Intronic
1122856800 14:104563871-104563893 CCCAGCCCAGTGGGGCCACGTGG - Intronic
1122893082 14:104742010-104742032 CCCAGCCCCTCGGGACCCCGTGG + Intronic
1122904490 14:104795556-104795578 CCCCGCCCAGCGCCGGCCCGCGG - Intronic
1123041047 14:105490370-105490392 CCCCGGGCAGCGTGTCACCGGGG - Intronic
1123707998 15:22964535-22964557 CCCTGCCCGGCAGCTCCCCGGGG + Intronic
1128133967 15:65249305-65249327 CCCCGCCCAGGGGCTGCCTGGGG - Intronic
1128987411 15:72231291-72231313 CCCCGCCCCCTGCGTCCCCGCGG + Exonic
1129789507 15:78331421-78331443 CCCGGGCCAGCGGGCCCCTGGGG + Intergenic
1131070193 15:89461200-89461222 CCCCGCCCAGCAGGCCCAAGTGG - Intergenic
1132378405 15:101348149-101348171 TCCGACCCAGCGGGACCCCGGGG - Intronic
1132583450 16:695385-695407 CCCCGCCCGGCGCGGCCCGGGGG + Intronic
1133270827 16:4610118-4610140 CGCCGCCCAGGGGTTCCCAGAGG + Intronic
1136399506 16:30010045-30010067 CCCCGCCCATCTGGTCCCCCTGG - Exonic
1136496989 16:30650898-30650920 CCCCGCCCAGCGGTCTCCCCCGG - Intronic
1136576768 16:31129949-31129971 CCCCACCCAGCTGGTTCCAGCGG - Intronic
1138537578 16:57668069-57668091 CCCACCCCAGTGGGGCCCCGGGG + Intergenic
1139631890 16:68236203-68236225 CCCCGCCCCGCGGGGCGCCACGG - Exonic
1140040323 16:71403214-71403236 CTCAGCCAAGCTGGTCCCCGTGG + Intergenic
1140504724 16:75464252-75464274 TCACGCCCAGCGGGACTCCGGGG + Intronic
1140512277 16:75517042-75517064 TCACGCCCAGCGGGGCTCCGGGG + Intergenic
1141989500 16:87602289-87602311 CCCCGCCCTGGGCTTCCCCGGGG - Intronic
1142156272 16:88534116-88534138 GCCGGCCCAGGGGGTCCCGGGGG - Exonic
1142173273 16:88633886-88633908 CCCCTCCCAGGGGGTGCCCCAGG + Intergenic
1142688591 17:1591710-1591732 CCCCCCCCACCCCGTCCCCGCGG - Intronic
1143174917 17:4950055-4950077 CCCCGCCCCGCCGGCCCGCGCGG - Intronic
1143181602 17:4987331-4987353 CCTCGCCCACCGCGTGCCCGCGG - Intronic
1143503480 17:7351818-7351840 TCCCTCCCAGCGGCTCCCCCGGG - Intergenic
1144729167 17:17516873-17516895 CCCCGCCCAGTGGCTACCCCAGG + Intronic
1145236838 17:21214312-21214334 CCCCGCCCCCGGGGTCGCCGGGG + Exonic
1145274061 17:21419665-21419687 CCCCACCCAGAGGGTCCTGGGGG + Exonic
1145311926 17:21705564-21705586 CCCCACCCAGAGGGTCCTGGGGG + Intergenic
1146063364 17:29618359-29618381 CCCCGCCCAGCGGGTCCACAAGG + Intronic
1146176416 17:30668529-30668551 CCCCCTCCAGCGGGGCCCCTTGG + Intergenic
1146349876 17:32084643-32084665 CCCCCTCCAGCGGGGCCCCTTGG + Intergenic
1148109260 17:45135662-45135684 CCCGGCCCTGCTGGACCCCGGGG + Intronic
1148356578 17:46979317-46979339 CCCCGCCCCGCCGGTCCCCGCGG + Intronic
1148930141 17:51120920-51120942 CCCCGCCCATCGGGCCGACGCGG - Intergenic
1149430815 17:56594472-56594494 CCCCGCCGGGCCGGTCCTCGGGG - Exonic
1151365386 17:73613361-73613383 CCCCGCCCTCCAGGTCCCCCTGG + Intronic
1151850197 17:76685446-76685468 CCCTGCCCAGCAGGTCCTCTCGG + Intronic
1152506836 17:80755049-80755071 CCCCTCCCAGGGTGTCCCTGGGG - Intronic
1152705405 17:81841094-81841116 CCCCGCACAGCTGGTCCACAGGG + Intergenic
1152808890 17:82371944-82371966 CCTCGCGCAGCGGGGCCGCGGGG - Intergenic
1152921961 17:83070248-83070270 CCCAGCCCAGCCGGTCAGCGCGG + Intergenic
1154133012 18:11752023-11752045 CCCCGCCCAGCGGGTCCCCGAGG - Intronic
1158241798 18:55386158-55386180 CCCCACCCAGGGAGTCCCCACGG + Intronic
1160014893 18:75133130-75133152 CACAGCCCTGTGGGTCCCCGTGG + Intergenic
1160502734 18:79410434-79410456 CCCCGCCCTGCCGCTCCCCACGG + Exonic
1160580982 18:79884477-79884499 CCCCGGCCACTGGGTCCCCGGGG + Intronic
1160844893 19:1161893-1161915 CCCCCCCCCGCGGCTCCCCAGGG - Intronic
1160860699 19:1236280-1236302 CTCTGCCCAGCGGGCCCCGGGGG + Intronic
1161060583 19:2212833-2212855 CCCCGCCCTGGGAGTCTCCGAGG + Intronic
1161252191 19:3286109-3286131 CTCAGCCCCGCGGGTCCCAGAGG - Intronic
1161371555 19:3914878-3914900 ACCCCCCCACCGGGTCCCCCTGG + Intronic
1161502324 19:4623183-4623205 CCCCGCCCCCAGTGTCCCCGAGG - Intergenic
1163584868 19:18157984-18158006 CCCCTCCTAGCGGGTGCCGGCGG - Intronic
1165213895 19:34255191-34255213 CCCGGCCCTCCCGGTCCCCGCGG - Intronic
1165949621 19:39466754-39466776 CCCAGCCCAGCCAGTCCCCAAGG - Intronic
1166106053 19:40598504-40598526 CCCAGCCCAGAGGGTCTCAGTGG - Intronic
1166259328 19:41626935-41626957 CCCCCCTCAGCCGCTCCCCGTGG - Exonic
1166986188 19:46661081-46661103 CCCAGCCCGGCCGGGCCCCGCGG + Exonic
1167074768 19:47241303-47241325 CCCCTCCCAGCCCTTCCCCGGGG - Intergenic
1167270376 19:48502539-48502561 CCGAGCCCAGCGGCCCCCCGAGG - Exonic
1167294036 19:48639127-48639149 CCCCGCCCACCTGCTCCCAGGGG - Intronic
1167466082 19:49651694-49651716 TCCCGCTCCGCGGGCCCCCGAGG + Exonic
1168056165 19:53866461-53866483 CCCCGCCCTGCCCCTCCCCGGGG + Intronic
1168345421 19:55648311-55648333 CCCCCGCCCGCGGGTGCCCGGGG - Exonic
925104840 2:1282631-1282653 CCCCGCACAGCGCGTCCCTCCGG + Intronic
925182104 2:1823999-1824021 CCCCCCCCAGCGGGGCCGCCGGG + Intronic
926098277 2:10096883-10096905 CCCAGCGCAGCGGCTCCCAGAGG + Intergenic
926801758 2:16665679-16665701 CCCCGCCTCGCGGTGCCCCGCGG + Intronic
927181201 2:20447750-20447772 CCCCGAGAAGTGGGTCCCCGAGG + Exonic
927702518 2:25277106-25277128 CCCCGCCCACGCGGCCCCCGCGG - Intronic
928964980 2:36966809-36966831 CCGCGCCCAGCCGGCCCCAGAGG - Intergenic
929188591 2:39120428-39120450 CCCCGCCCAGAGGCGCCCCGGGG - Exonic
932771522 2:74503215-74503237 CCACGCCCACCCGGACCCCGGGG - Intronic
933655206 2:84881121-84881143 CCCCGCCCGGAGGCGCCCCGCGG - Exonic
937360195 2:121224287-121224309 CCCAGCCCTGTGGATCCCCGTGG - Exonic
938381108 2:130837090-130837112 CCCCACCCACCGGGTGCCCAGGG - Intronic
941666543 2:168247908-168247930 CCCCGCCCTCGGGGTCCCCAGGG - Exonic
942578595 2:177392749-177392771 CCGCGCCCAGCGGTTCCGGGCGG + Exonic
946431079 2:219627739-219627761 CCCCGCCCCGCGGTACCTCGGGG - Exonic
948461278 2:238131071-238131093 CCCCGCCCAGCGAGGGCCCCCGG + Exonic
1172331674 20:34079989-34080011 CACCCCCCAGCGGGTACCAGAGG + Exonic
1173488465 20:43458538-43458560 CCCCGCCCCCAGGGTCCCCAAGG - Intronic
1173939151 20:46895022-46895044 CCCCGCCCGGCGAATCCCGGCGG - Intronic
1174648673 20:52106155-52106177 CCCCGCCCAGCAGGTGACGGAGG + Intronic
1175888058 20:62303273-62303295 CCCCGCGGAGCGGGTCGCCGGGG + Intronic
1175984618 20:62758472-62758494 CCCTGCCCAGGGGGTCGCCGGGG - Intronic
1176131575 20:63498800-63498822 CCCGGCCCGCAGGGTCCCCGCGG + Intronic
1176546689 21:8205401-8205423 CCACGCGCGGCGGGTCCCCGCGG - Intergenic
1176554584 21:8249591-8249613 CCACGCGCGGCGGGTCCCCGCGG - Intergenic
1176565640 21:8388448-8388470 CCACGCGCGGCGGGTCCCCGCGG - Intergenic
1176573505 21:8432616-8432638 CCACGCGCGGCGGGTCCCCGCGG - Intergenic
1178543027 21:33470964-33470986 CCCAGCCCAGGGAGTCCCCTTGG + Intronic
1179150859 21:38806637-38806659 CCGCGCCCCGCAGGTTCCCGCGG - Intronic
1179346260 21:40560334-40560356 CCCCACACAGGGGGTCCCCCTGG - Intronic
1181026780 22:20131615-20131637 CCCAGCCCGGCGGGCGCCCGCGG - Intronic
1181690323 22:24555476-24555498 TCCCGCCCAGTGCATCCCCGAGG + Intronic
1182189266 22:28442411-28442433 CGCCCCCCAGCGGGGCCCTGGGG + Intronic
1182291884 22:29286399-29286421 CCCCTCCCAGCTGGGCACCGTGG + Intronic
1182360618 22:29744436-29744458 CCCCACCCTGCTGGTCCCCCTGG - Intronic
1183253038 22:36743855-36743877 CCCTGCCCGGCAGGTCCCCAGGG - Intergenic
1183942208 22:41302164-41302186 CCCCGCGCAGGGGGTCTCGGGGG + Intronic
1184106241 22:42368977-42368999 CCACGCGCAGCGGCTCCGCGGGG - Intergenic
1184362024 22:44024478-44024500 CACCGCCGGGCAGGTCCCCGGGG - Intronic
1185420197 22:50730769-50730791 CCCCGCCGCCCGGGCCCCCGGGG - Intergenic
1203251554 22_KI270733v1_random:121667-121689 CCACGCGCGGCGGGTCCCCGCGG - Intergenic
1203259604 22_KI270733v1_random:166749-166771 CCACGCGCGGCGGGTCCCCGCGG - Intergenic
950316423 3:12005042-12005064 CTCCTCCCAGCGGGACCTCGGGG - Intronic
950518115 3:13480383-13480405 GCCCGCCCACCGGGACCCCTGGG - Intronic
950670822 3:14524379-14524401 CCCCGCCCGGTGGGTGCCCTTGG - Exonic
961551337 3:127672168-127672190 CCCCACCCAGGGGGTTCCCGCGG - Intronic
962809262 3:138947273-138947295 CCCCGCCCAGCGAGCCTCAGGGG + Exonic
967980157 3:195060802-195060824 CCCAGCCCAGCGTGCCCCAGTGG - Intergenic
968942377 4:3645445-3645467 CCCTGTCCAGCTGGTCCCTGAGG + Intergenic
970636935 4:18021055-18021077 CCCCGCCCTGCGAGTGCCCGTGG + Intronic
971351820 4:25862625-25862647 CCCCTCCGCGCGGGGCCCCGGGG - Intronic
975485738 4:74933021-74933043 CCCCTCCCACCCGGGCCCCGCGG - Intergenic
976874402 4:89836624-89836646 CCTGGCCCAGCGGGTCCTCATGG + Intronic
985336675 4:188904834-188904856 CGCAGCCCAGAGGGTCCCCTCGG - Intergenic
985548948 5:523782-523804 TCGCGCCCAGGGAGTCCCCGGGG - Intronic
986169337 5:5303258-5303280 CCCTGCCCAGCTGGTCCGTGGGG + Exonic
987101409 5:14594529-14594551 CCCAGGCCAGGGGGTCCCTGTGG + Intronic
992104205 5:73436816-73436838 CTCCGCCCCGCCGGGCCCCGCGG + Intergenic
995402538 5:111758153-111758175 CCCCGCCCCGGGCTTCCCCGCGG - Intronic
998157929 5:139796653-139796675 CCCTGCCCAGCGGGCCCCCTCGG + Intronic
998407685 5:141883225-141883247 CGGCGGCCACCGGGTCCCCGGGG - Intergenic
1000345849 5:160312633-160312655 CCCCGCCCCGCGGGGCGCGGGGG - Intronic
1002181232 5:177432128-177432150 CCCAGCCCCGCGGGTGGCCGAGG + Intronic
1002187261 5:177460144-177460166 CCCAGCCGAGCTGCTCCCCGTGG + Intronic
1002296259 5:178232840-178232862 CCCCGCCCCGCAGGCCCCTGCGG + Intergenic
1005928415 6:30463847-30463869 CCCCGCCCAGCGGTGGCCCAGGG + Intergenic
1007644461 6:43369529-43369551 CCCGGCCGAGCGCGCCCCCGCGG + Intergenic
1018197658 6:161368954-161368976 CCTCACCCAGCGGATCCACGGGG + Intronic
1018679643 6:166253355-166253377 CTCCGCCCAGTGGCTTCCCGCGG - Intergenic
1018892190 6:167990148-167990170 CCACGCCCGGTGAGTCCCCGGGG + Intergenic
1026482475 7:70790471-70790493 CCCTGCCCAGCGGGTCTCTCCGG - Exonic
1028121448 7:87059799-87059821 CCCAGCCCGGCGGGTCCCCAGGG + Intergenic
1028198496 7:87934368-87934390 CCGCGCCCCCGGGGTCCCCGCGG - Exonic
1028712140 7:93921746-93921768 CCCAGCCCAGCCGTCCCCCGCGG + Exonic
1029547370 7:101217388-101217410 CCCAGCCAAGCTGCTCCCCGCGG - Exonic
1029630648 7:101748100-101748122 CCCCGCCCAGCGCGGCCCCTCGG - Intergenic
1033324029 7:140362956-140362978 CCCCGCCCAGCCGGCCGCCCCGG + Intronic
1034412239 7:150947660-150947682 CCCCACCCGGCGGCTCTCCGGGG + Exonic
1035237459 7:157508180-157508202 CCCCGCCCAGGCAGTCCCTGCGG - Intergenic
1036564297 8:9925165-9925187 CAGCGCCCAGAGGGTCCCCTTGG + Intergenic
1038176335 8:25184704-25184726 CCCGGCCCAGCAGGTGACCGCGG + Intronic
1039467959 8:37797234-37797256 CCCAGCGCTGTGGGTCCCCGCGG + Exonic
1048976827 8:139677851-139677873 CCCAGCCCAAGGGGTCCCCATGG + Intronic
1048976849 8:139677983-139678005 CCCAGCCCAACAGGTCCCCACGG + Intronic
1049441299 8:142610958-142610980 CCCGGCCCAGAGGGTCACCCTGG - Intergenic
1049671649 8:143872746-143872768 CCCCGCCCAGGGAGTGCTCGTGG - Exonic
1055514360 9:77020949-77020971 CCACGCCCGCCGGGTCCCCTAGG - Exonic
1058005137 9:99906575-99906597 CCCCGCCCCGCAGGGCCCCCAGG - Intergenic
1058055202 9:100442111-100442133 CTCAGCCCAGCGTGTCCCTGCGG + Exonic
1059670249 9:116484407-116484429 CCCAGCCCTGCGTGTCCCCAAGG + Intronic
1060016909 9:120094664-120094686 CCCCGCCCTGTGTGTCCCCTGGG - Intergenic
1060412134 9:123406819-123406841 CCCTGCCCCGCGGGGCCCCGGGG + Intronic
1060811205 9:126612506-126612528 CCCTGCGCCGCGGGGCCCCGCGG - Intergenic
1061187459 9:129063186-129063208 CCCTGCCCAGCGATGCCCCGGGG - Intronic
1061407765 9:130402230-130402252 CCCCACCCAGCAGGCCCCCAGGG + Intronic
1061905184 9:133693021-133693043 CACTGCCCAGCGGGTCTTCGGGG - Intronic
1203467956 Un_GL000220v1:104818-104840 CCACGCGCGGCGGGTCCCCGCGG - Intergenic
1203475777 Un_GL000220v1:148790-148812 CCACGCGCGGCGGGTCCCCGCGG - Intergenic
1186349978 X:8731367-8731389 CCCAGCCCCGCAGGTGCCCGCGG - Intronic
1186378431 X:9033236-9033258 GCCCGTCCAGCCCGTCCCCGGGG + Intronic
1186795524 X:13044006-13044028 GCCCGTCCAGCGCTTCCCCGGGG + Intronic
1199772781 X:150984541-150984563 CCCGGCCCCGCGCGTCCCCCGGG + Intronic
1200277772 X:154750869-154750891 CGGAGCCCAGCGGCTCCCCGCGG + Intronic
1200303934 X:155006403-155006425 CACCTTCCAGCAGGTCCCCGGGG + Intronic
1200317452 X:155148503-155148525 CACCTTCCAGCAGGTCCCCGGGG - Intergenic