ID: 1154134345

View in Genome Browser
Species Human (GRCh38)
Location 18:11762516-11762538
Sequence TCAGTGTGACGCCAGCTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 133}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154134345_1154134354 19 Left 1154134345 18:11762516-11762538 CCATGCAGCTGGCGTCACACTGA 0: 1
1: 0
2: 0
3: 14
4: 133
Right 1154134354 18:11762558-11762580 GGACGGGCTTAGAGGGCAGGTGG 0: 1
1: 0
2: 3
3: 24
4: 248
1154134345_1154134348 2 Left 1154134345 18:11762516-11762538 CCATGCAGCTGGCGTCACACTGA 0: 1
1: 0
2: 0
3: 14
4: 133
Right 1154134348 18:11762541-11762563 TGAATCTTCCTTGAATGGGACGG 0: 1
1: 0
2: 0
3: 17
4: 231
1154134345_1154134351 11 Left 1154134345 18:11762516-11762538 CCATGCAGCTGGCGTCACACTGA 0: 1
1: 0
2: 0
3: 14
4: 133
Right 1154134351 18:11762550-11762572 CTTGAATGGGACGGGCTTAGAGG 0: 1
1: 0
2: 2
3: 8
4: 102
1154134345_1154134346 -3 Left 1154134345 18:11762516-11762538 CCATGCAGCTGGCGTCACACTGA 0: 1
1: 0
2: 0
3: 14
4: 133
Right 1154134346 18:11762536-11762558 TGAGCTGAATCTTCCTTGAATGG 0: 1
1: 0
2: 1
3: 22
4: 189
1154134345_1154134355 30 Left 1154134345 18:11762516-11762538 CCATGCAGCTGGCGTCACACTGA 0: 1
1: 0
2: 0
3: 14
4: 133
Right 1154134355 18:11762569-11762591 GAGGGCAGGTGGACATAGAGAGG 0: 1
1: 0
2: 2
3: 66
4: 557
1154134345_1154134353 16 Left 1154134345 18:11762516-11762538 CCATGCAGCTGGCGTCACACTGA 0: 1
1: 0
2: 0
3: 14
4: 133
Right 1154134353 18:11762555-11762577 ATGGGACGGGCTTAGAGGGCAGG 0: 1
1: 0
2: 0
3: 8
4: 145
1154134345_1154134352 12 Left 1154134345 18:11762516-11762538 CCATGCAGCTGGCGTCACACTGA 0: 1
1: 0
2: 0
3: 14
4: 133
Right 1154134352 18:11762551-11762573 TTGAATGGGACGGGCTTAGAGGG 0: 1
1: 0
2: 0
3: 6
4: 94
1154134345_1154134347 -2 Left 1154134345 18:11762516-11762538 CCATGCAGCTGGCGTCACACTGA 0: 1
1: 0
2: 0
3: 14
4: 133
Right 1154134347 18:11762537-11762559 GAGCTGAATCTTCCTTGAATGGG 0: 1
1: 0
2: 1
3: 17
4: 198
1154134345_1154134349 3 Left 1154134345 18:11762516-11762538 CCATGCAGCTGGCGTCACACTGA 0: 1
1: 0
2: 0
3: 14
4: 133
Right 1154134349 18:11762542-11762564 GAATCTTCCTTGAATGGGACGGG 0: 1
1: 0
2: 0
3: 8
4: 121

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154134345 Original CRISPR TCAGTGTGACGCCAGCTGCA TGG (reversed) Intronic
901399330 1:9005239-9005261 TCAGAGTGACGCCAGCGCAAAGG - Intronic
903005120 1:20293332-20293354 TCTGTGAGAGGCCAGCTCCATGG + Intronic
903765525 1:25731911-25731933 CTAGTGTGATGCCAGGTGCATGG - Intronic
905667088 1:39769702-39769724 TCAGGGTGCCACCTGCTGCATGG + Exonic
911563810 1:99438790-99438812 TCAGTGTGAAGCCCGCAGCCCGG - Intergenic
913549069 1:119898719-119898741 TCTCTGTGACGTCAGCTGCTGGG + Intergenic
916273799 1:162971951-162971973 TCAGTGTGAGGCCAACAGCATGG - Intergenic
916340716 1:163730578-163730600 TTATTGTGAAGCCAGCTGCGTGG + Intergenic
920963265 1:210682465-210682487 TGTGTGTGAGGCCAGCAGCATGG + Exonic
921567387 1:216736514-216736536 TCAGTGTGACGTCAACTTGAGGG - Intronic
1063383511 10:5601682-5601704 TCAGGGGAATGCCAGCTGCAAGG - Intergenic
1063494611 10:6495337-6495359 CCAGTGTGGTGACAGCTGCAAGG - Intronic
1064465817 10:15580804-15580826 CAAGTTTGATGCCAGCTGCAGGG - Intronic
1064674771 10:17749903-17749925 TCAGTGTGACAGCAGGTACAGGG + Intergenic
1067770945 10:49124722-49124744 TCAGTGTAAAGACAGATGCAAGG - Intergenic
1068888878 10:62127535-62127557 TGAATGTGATGCCAGCTGCCTGG - Intergenic
1072441454 10:95459713-95459735 TCAGAGTGAAGCCAGCTGCCAGG + Intronic
1073945027 10:108740679-108740701 TCAGTGTGAACTCAGCTGGAGGG - Intergenic
1074833354 10:117265332-117265354 TGAGTGTGTGGCCAGCTGCTGGG + Intronic
1075028233 10:119002729-119002751 TCAGGGTGAAGGCAGCAGCAAGG + Intergenic
1075464906 10:122643897-122643919 CCATGGGGACGCCAGCTGCATGG + Intergenic
1076543945 10:131231478-131231500 GCAGTGCCACGGCAGCTGCAGGG - Intronic
1077382226 11:2249561-2249583 CCGGTGTGACGACAACTGCAAGG + Intergenic
1077392677 11:2307313-2307335 TCAGGGTGATGCCAGGAGCATGG - Intronic
1082139851 11:48595981-48596003 TCAGACTGAAGCCTGCTGCAGGG - Intergenic
1083365553 11:62139709-62139731 TCAGGGCCACACCAGCTGCATGG + Intronic
1084757104 11:71246554-71246576 TCAGTTTGAAGCCCCCTGCAAGG - Intronic
1085229298 11:74950834-74950856 TGAGTGTGAGGCCAGGTGCATGG - Intronic
1091105487 11:132915352-132915374 TCATTCTCACACCAGCTGCAAGG + Intronic
1092319789 12:7460163-7460185 ACAGTGTGACACCAGCTGTGTGG + Intronic
1096528148 12:52225997-52226019 TCAGTGTGCTGCCAGCTTGAAGG + Intergenic
1102792808 12:115661524-115661546 AGAGTGTGATGCCAGATGCATGG + Intergenic
1104043122 12:125143508-125143530 TCAGTGTGAAGCCAGCACCCTGG + Intergenic
1104221200 12:126786635-126786657 TCAGTGTGTCTCCCACTGCAGGG + Intergenic
1106402336 13:29442481-29442503 TCAGTGTGAAACAAGATGCAAGG - Intronic
1106484420 13:30159700-30159722 TCAGGGTGACTCCAGCCACATGG - Intergenic
1111419857 13:87998500-87998522 TCAGGCAGAAGCCAGCTGCAGGG + Intergenic
1113511611 13:110859916-110859938 TCAGTGTGATGCCTGCTGTAAGG + Intergenic
1113530973 13:111026773-111026795 TCAGTGTGATGCCTGCTGTAAGG - Intergenic
1113754463 13:112801018-112801040 TAAGTATGACGTCAGCTGTAGGG - Intronic
1114620903 14:24095397-24095419 TCAGTGTGGCCCCAGGGGCAGGG - Intronic
1114630446 14:24156188-24156210 TCAGAGAGAAGCCAGCTGCCAGG + Intronic
1117444967 14:55795402-55795424 TCAATGTGGGGACAGCTGCAGGG + Intergenic
1122265153 14:100543174-100543196 CCAGGGAGTCGCCAGCTGCAGGG - Intronic
1123995635 15:25716199-25716221 CCAATGTGTCTCCAGCTGCATGG + Intronic
1125430428 15:39588220-39588242 TAAGTGTGAGGTCCGCTGCAAGG + Intronic
1128513493 15:68327690-68327712 TCAATGAGACCCCAGCAGCAGGG - Intronic
1128557235 15:68640085-68640107 TCACTGTGAGGTCAGATGCATGG - Intronic
1129050660 15:72779200-72779222 TCAGGGTGAAGCCAGTTCCAGGG + Intronic
1129168001 15:73789959-73789981 TCAGTGTGAGGCCAGGGTCAAGG + Intergenic
1130985181 15:88840148-88840170 CCAGTGTGACGCCGGCTGGCTGG + Exonic
1132981363 16:2740078-2740100 TCAGTATGGGGGCAGCTGCAGGG - Intergenic
1133342865 16:5048320-5048342 TCAGCTTGAGACCAGCTGCAGGG - Intronic
1133403644 16:5506531-5506553 GCAGTGTGTGGGCAGCTGCAGGG - Intergenic
1134443558 16:14313905-14313927 GCAGTGTGACCTCAGATGCAGGG + Intergenic
1138389333 16:56658742-56658764 TGAGTGTGAGGCCATCTCCATGG + Intronic
1140154603 16:72410665-72410687 ACTGTGTGACCTCAGCTGCATGG + Intergenic
1141589929 16:85061711-85061733 TCAGTGTGAGCACAGCTCCATGG + Intronic
1142114275 16:88348286-88348308 GCAGTGTGAAGCCAGAGGCAGGG - Intergenic
1143316432 17:6036779-6036801 TCAGTGTATCTCCAGCTGGAGGG - Intronic
1144889681 17:18487516-18487538 TCAGTGTGGGGCCAGTTACAGGG - Intronic
1145142530 17:20456780-20456802 TCAGTGTGGGGCCAGTTACAGGG + Intronic
1145247516 17:21279343-21279365 TCACTGTGATGCAAGCTGCACGG - Intergenic
1147333063 17:39710156-39710178 GCAGTGTGCTGCCGGCTGCACGG + Exonic
1148245030 17:46024892-46024914 TCAGTGTGCCACCCTCTGCAGGG + Exonic
1152004172 17:77667339-77667361 TCAGTGTGGGGACAGCTGTAAGG + Intergenic
1152761106 17:82107443-82107465 TCCGTTTGACTCCAGCTGCACGG + Intronic
1154134345 18:11762516-11762538 TCAGTGTGACGCCAGCTGCATGG - Intronic
1167986478 19:53322600-53322622 TGATTGTTACACCAGCTGCATGG - Intergenic
925177743 2:1797113-1797135 TCAGTGTGGCCTCAGCTTCAAGG - Intronic
926019031 2:9478686-9478708 TCAGTGTGATGCAAGCCACAAGG - Intronic
929461657 2:42106401-42106423 TCTGAGTGATCCCAGCTGCAGGG - Intergenic
929881310 2:45839570-45839592 TTTGTGTCACGCCAGCTGCCTGG + Intronic
933185167 2:79270403-79270425 TCAGAGTGACGCCAGTCCCAAGG + Intronic
934205547 2:89926291-89926313 TCAGTCTGACTCCTGCTGAAGGG + Intergenic
935037129 2:99388399-99388421 TAAGTATGATGTCAGCTGCAGGG + Intronic
937523673 2:122741550-122741572 TGAGTGAGACGCCAGCAACAGGG + Intergenic
943516988 2:188900850-188900872 TCACTGTGACTGCAGCTGAATGG - Intergenic
943570786 2:189572363-189572385 TCAATATGACACCAGATGCATGG + Intronic
944916392 2:204364938-204364960 TCAGAGTGTGGGCAGCTGCAGGG - Intergenic
948972802 2:241442227-241442249 TCAATCTGAGGCCAGCTCCATGG + Intronic
1171295461 20:24012921-24012943 TCAGTGTGACCCCCTCTGAATGG + Intergenic
1171360444 20:24583085-24583107 TCACTGTGCAGCCAGCCGCAGGG - Intronic
1171364144 20:24612261-24612283 ACAGTGTGACCCTAGCTGAAGGG + Intronic
1172110023 20:32539080-32539102 TCAGTTTCTTGCCAGCTGCAGGG + Intronic
1173254876 20:41387211-41387233 TCAGTCTGGGGACAGCTGCAGGG - Intergenic
1178848602 21:36194210-36194232 TCTGTGTGACGACAGCTCCAAGG + Intronic
1180141901 21:45898155-45898177 TCTCTGTGAGGCCAGGTGCACGG + Intronic
1181261262 22:21599517-21599539 TGAGTGTGGCTCCACCTGCAAGG + Intronic
1182041740 22:27243396-27243418 GCAGTGTGACGACGGCTGCAGGG + Intergenic
1182918771 22:34060327-34060349 TCACTGCAATGCCAGCTGCAAGG - Intergenic
1183082370 22:35464686-35464708 CCAGTGTAACCCCAGCTACAAGG - Intergenic
952367212 3:32685414-32685436 TCAGGGCCACGCCACCTGCAGGG + Intronic
954661831 3:52230558-52230580 TCAGTGTGACCCCAGGGGTATGG + Intronic
960724724 3:120658723-120658745 TCAGGCAGAAGCCAGCTGCAGGG - Intronic
962939669 3:140114370-140114392 TAAGGGTGATGCCAGATGCAGGG - Intronic
966571519 3:181449375-181449397 TCAGTGTGAGGCCAGGCGCAGGG + Intergenic
967535996 3:190604246-190604268 TCAGAGTAAGGCCAGCTGAATGG - Exonic
967633483 3:191774576-191774598 TAAGTGTGTGGCCAACTGCATGG - Intergenic
967668778 3:192206880-192206902 TCAGTGTGAAGGAAGCTTCAGGG - Intronic
968897411 4:3412882-3412904 CCAGTGTGAGCCCAGCTTCAGGG - Intronic
969877591 4:10147289-10147311 TCACTGTCAAGCCAGCTGGAGGG + Intergenic
973836709 4:54817480-54817502 TCAGTATGAGGCCTGGTGCAGGG - Intergenic
981173779 4:141656240-141656262 TCCATGTGACGTCAGCAGCATGG - Exonic
984003738 4:174283602-174283624 TCAGGGTACCTCCAGCTGCAGGG + Exonic
987770020 5:22289939-22289961 TCAGTGTTAGGCCAGCTTCAGGG + Intronic
990787414 5:59438034-59438056 TCACTATCACGACAGCTGCATGG + Intronic
994090701 5:95807463-95807485 TCTGTGTGGCGGCAGCAGCAAGG - Intronic
995350494 5:111169488-111169510 TCAGTGTTAGGCAAGCAGCAAGG + Intergenic
997371466 5:133363875-133363897 TCAGTGTGAGGCCAGCTCAGCGG - Intronic
997588003 5:135055563-135055585 TAAGTGTGGCCCCAGCTGCCAGG + Intronic
1000926863 5:167204621-167204643 TCACTGTGATGCCAGGGGCAGGG + Intergenic
1003060536 6:2859015-2859037 TCAGTATGGCTCCAGCTGAATGG + Intergenic
1003199608 6:3947019-3947041 ACAGTGTGACGTCACCTGCAAGG + Intergenic
1003989775 6:11474215-11474237 TCAGTGTCAGGCTAGTTGCAAGG - Intergenic
1004132823 6:12937171-12937193 TCTGTGTTAGGCTAGCTGCATGG + Intronic
1018564404 6:165136589-165136611 TCAGGCTGAAGCCTGCTGCAGGG + Intergenic
1019319730 7:410159-410181 GCAGTGTGACCCCAGGAGCATGG + Intergenic
1020226591 7:6285156-6285178 TCAGCGTCTCGCCAGCTCCATGG - Intergenic
1021553165 7:21893497-21893519 TCAGAGTGATGCCAGCTGGCAGG + Intronic
1023865818 7:44237897-44237919 CCAGTGTCCGGCCAGCTGCAGGG - Intronic
1034242305 7:149619962-149619984 TCAGGGCGGCGCCAGTTGCAGGG + Intergenic
1034497364 7:151430930-151430952 TCAGTGGGGGGCCAGGTGCATGG - Intronic
1035375781 7:158405784-158405806 TCAGTGTGCGGCCACATGCATGG - Intronic
1037862518 8:22415959-22415981 TCAGTGGGCCACCAGCTGCTTGG + Intronic
1040652951 8:49470035-49470057 TAAGTATGAGGTCAGCTGCAGGG - Intergenic
1040995344 8:53395623-53395645 TCAGTGAGAGGCAAGTTGCAAGG + Intergenic
1042670973 8:71263037-71263059 TCAGTGTGGCTAGAGCTGCAAGG + Intronic
1046174298 8:110554712-110554734 TCAGGGAGAAGTCAGCTGCAAGG + Intergenic
1046317891 8:112531006-112531028 CCAGTGTGACATCAGCTGCGGGG + Intronic
1047801247 8:128312861-128312883 TCAGTTTAAAGCCATCTGCAGGG + Intergenic
1049003761 8:139842017-139842039 GCAGTGTGAGTCCAGCTGAAAGG + Intronic
1051368659 9:16339679-16339701 TCAGTGTGAAACCACATGCACGG + Intergenic
1053018122 9:34675701-34675723 TCAGAGTGACCCAAACTGCAGGG - Intergenic
1057332515 9:94129040-94129062 TCAGGCAGAAGCCAGCTGCAGGG + Intergenic
1058291792 9:103251558-103251580 CCAGTGTGCAGCCAGATGCAAGG + Intergenic
1060156015 9:121320288-121320310 TCAGTGTGACCCCTGCTGGCAGG - Intronic
1060976518 9:127768201-127768223 GCAGGGTGACGTCAGCTGCTGGG - Intronic
1061932577 9:133840851-133840873 TCACTGTGCCTACAGCTGCATGG + Intronic
1062448623 9:136606260-136606282 CCTGGGTGACGCCAGCTGCCTGG + Intergenic
1188810144 X:34643771-34643793 TCAATGTCACGCCAGCTGATTGG + Intronic
1189214169 X:39309106-39309128 TCTGTGTGACGCCCCCTGCAAGG + Intergenic
1191882523 X:65857138-65857160 TCAGTGTGCCCCTAGCTGCAAGG - Intergenic
1193066145 X:77262489-77262511 TCAATGTGATTCCATCTGCAAGG + Intergenic
1194049632 X:89053163-89053185 CCAGGGAGAAGCCAGCTGCAGGG - Intergenic
1197152779 X:123238284-123238306 TCAATGTGACTCCAGCTGGGTGG + Intronic
1198223415 X:134623641-134623663 TCTGAGTGGGGCCAGCTGCATGG + Intronic
1201695759 Y:16823940-16823962 TCACTGTAACGCCACCTCCAGGG + Intergenic