ID: 1154134817

View in Genome Browser
Species Human (GRCh38)
Location 18:11767077-11767099
Sequence CCAGTTTGATATTTCTGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 4, 3: 13, 4: 148}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154134813_1154134817 -3 Left 1154134813 18:11767057-11767079 CCCATTTGTATTTTACAGACCCA 0: 1
1: 0
2: 4
3: 18
4: 237
Right 1154134817 18:11767077-11767099 CCAGTTTGATATTTCTGCCCAGG 0: 1
1: 0
2: 4
3: 13
4: 148
1154134814_1154134817 -4 Left 1154134814 18:11767058-11767080 CCATTTGTATTTTACAGACCCAG 0: 1
1: 0
2: 1
3: 23
4: 250
Right 1154134817 18:11767077-11767099 CCAGTTTGATATTTCTGCCCAGG 0: 1
1: 0
2: 4
3: 13
4: 148
1154134809_1154134817 7 Left 1154134809 18:11767047-11767069 CCCTCCCATACCCATTTGTATTT 0: 1
1: 0
2: 0
3: 26
4: 298
Right 1154134817 18:11767077-11767099 CCAGTTTGATATTTCTGCCCAGG 0: 1
1: 0
2: 4
3: 13
4: 148
1154134810_1154134817 6 Left 1154134810 18:11767048-11767070 CCTCCCATACCCATTTGTATTTT 0: 1
1: 0
2: 0
3: 26
4: 346
Right 1154134817 18:11767077-11767099 CCAGTTTGATATTTCTGCCCAGG 0: 1
1: 0
2: 4
3: 13
4: 148
1154134812_1154134817 2 Left 1154134812 18:11767052-11767074 CCATACCCATTTGTATTTTACAG 0: 1
1: 0
2: 4
3: 26
4: 231
Right 1154134817 18:11767077-11767099 CCAGTTTGATATTTCTGCCCAGG 0: 1
1: 0
2: 4
3: 13
4: 148
1154134811_1154134817 3 Left 1154134811 18:11767051-11767073 CCCATACCCATTTGTATTTTACA 0: 1
1: 0
2: 2
3: 23
4: 300
Right 1154134817 18:11767077-11767099 CCAGTTTGATATTTCTGCCCAGG 0: 1
1: 0
2: 4
3: 13
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154134817 Original CRISPR CCAGTTTGATATTTCTGCCC AGG Intronic
903135015 1:21303575-21303597 CCAGTTTGTGAGTTCTGCCTTGG - Intronic
903320505 1:22540421-22540443 CCAGTTTAATTTTTCTCCCTGGG - Intergenic
903802889 1:25982943-25982965 CCATTTTGTTACTTCTCCCCAGG + Intronic
905919959 1:41712789-41712811 CCAGTTTGTTGCTTCTCCCCAGG - Intronic
907630302 1:56074422-56074444 CCAGTTTGTTCTATCAGCCCAGG + Intergenic
909442055 1:75707793-75707815 CAAATTTGATATTTTTCCCCTGG - Intergenic
911593273 1:99772032-99772054 CAAGTGAGATATTTCTGGCCTGG + Intergenic
913277137 1:117149336-117149358 TGGGTTTGATATTTCTACCCAGG - Intronic
915697260 1:157756385-157756407 CCAGTTTGGGATATCTGGCCAGG + Intronic
916609666 1:166378931-166378953 AGAGTGGGATATTTCTGCCCTGG + Intergenic
919060537 1:192626716-192626738 CCAGTTTCTTATCTCTCCCCAGG - Intergenic
920799391 1:209173215-209173237 CCAGTTTGACTTCTCAGCCCAGG + Intergenic
1064595889 10:16944563-16944585 CCTGTGAGTTATTTCTGCCCTGG - Intronic
1067298827 10:44991674-44991696 TCAGTTTAATATTTCCTCCCAGG + Intronic
1067794694 10:49312272-49312294 CCATTTTTAAATTCCTGCCCAGG + Intronic
1068267085 10:54665419-54665441 CCAGTTTTCTATTTCTGCCCAGG + Intronic
1068490953 10:57723062-57723084 CCAGCTTCATATGTCTGTCCTGG - Intergenic
1068625767 10:59244782-59244804 CCAGTTTGATTTTTCTGGCCAGG + Intronic
1075184222 10:120240409-120240431 CGGGTTTGACATTTTTGCCCTGG + Intergenic
1077925953 11:6682341-6682363 CCAGTTTGATCTTTGTACCGAGG + Exonic
1078920754 11:15828021-15828043 CAAATTTGCTATTTCTGCCCTGG - Intergenic
1079887951 11:26012714-26012736 CCAGTCTGATTTTCATGCCCAGG + Intergenic
1080078491 11:28182452-28182474 CCAGTTTCAGTTTTCTGCCTAGG + Intronic
1080118386 11:28646209-28646231 CCAGTTTCAGTTTTCTGCACAGG - Intergenic
1080724354 11:34880644-34880666 CCAGTTGTATATTTCTTTCCTGG - Intronic
1088138482 11:106586149-106586171 CCAGTTTGTTCTTTTTGCTCAGG + Intergenic
1088440768 11:109867638-109867660 ACAGTGTAATATTGCTGCCCGGG - Intergenic
1091319883 11:134641882-134641904 GCATTTTCATTTTTCTGCCCGGG - Intergenic
1093504303 12:19847236-19847258 TGAGTTTTATTTTTCTGCCCTGG + Intergenic
1093617573 12:21246169-21246191 CCAGTTTGTTCTTTTTGCTCAGG - Intergenic
1094219424 12:27975841-27975863 CTAGATTGATTTTTATGCCCTGG - Intergenic
1095124191 12:38456428-38456450 TGAGCTTGGTATTTCTGCCCTGG - Intergenic
1100875961 12:98962034-98962056 CCATTTTGATATTTGTTTCCTGG - Intronic
1101662257 12:106775979-106776001 CCAGTATGCCATTTCTGCCCCGG - Intronic
1101813032 12:108123989-108124011 CCAGATTAATATTTCAGCCCCGG + Intergenic
1102699762 12:114828978-114829000 CAAGGTTGTTATTTCTGTCCTGG - Intergenic
1104565323 12:129875910-129875932 CCATTTTGTTAATTCTGGCCTGG + Intronic
1105051076 12:133051637-133051659 TGTGTTTGATGTTTCTGCCCAGG + Intronic
1105583640 13:21723946-21723968 CCGGGTAGATAGTTCTGCCCCGG + Intergenic
1108151162 13:47536116-47536138 CCAGTTTCAGTTTTCTGCACAGG - Intergenic
1110671114 13:78179276-78179298 CCAGTTTCATTTTTCTGCATAGG + Intergenic
1112957553 13:105079972-105079994 CCAGGTTGATATTTTTATCCTGG - Intergenic
1115293872 14:31803821-31803843 TCAGTTTGAAACTTCAGCCCTGG + Intronic
1115842877 14:37491231-37491253 ATAGTTGGATATTTCTGGCCAGG + Intronic
1118966108 14:70587126-70587148 TATGTGTGATATTTCTGCCCAGG - Intronic
1120054309 14:79904675-79904697 CCAGTTTGATTTCTCTTCACAGG - Intergenic
1121843988 14:97157308-97157330 CCTGTTTTATATTTTTCCCCAGG - Intergenic
1122426947 14:101615700-101615722 GCCTTTTGATATTTCTGCACAGG - Intergenic
1122954523 14:105064357-105064379 CCAATTTGATAGTGTTGCCCAGG + Intronic
1123989562 15:25673304-25673326 CTTGTTTGAAATTTCTGCCAAGG - Intergenic
1128260216 15:66227996-66228018 CCAGGTTCCTATTCCTGCCCTGG + Intronic
1131879628 15:96849246-96849268 GCAGTTAGAGATTTCTGGCCGGG - Intergenic
1133565637 16:6991004-6991026 ACAGTTGGCTATTTCTGGCCAGG + Intronic
1140605570 16:76532739-76532761 CTTGTTGGATATTTCTTCCCTGG - Intronic
1141918955 16:87122015-87122037 CCAGTCTGCTCTCTCTGCCCGGG - Intronic
1144956671 17:19022096-19022118 CCAGTTTGACTTCTCAGCCCAGG - Exonic
1145909314 17:28533415-28533437 CCAGTGTGGTAATTGTGCCCAGG - Intronic
1146582010 17:34046810-34046832 CCAGTTTGTTCTTTCAGGCCTGG + Intronic
1149984519 17:61337151-61337173 CAAGCCTGATATTTCTGCCCAGG + Intronic
1152256662 17:79243930-79243952 CCAGTGTGGCATCTCTGCCCTGG + Intronic
1152935136 17:83132333-83132355 CCTGCTTGGTAATTCTGCCCAGG - Intergenic
1153095521 18:1397577-1397599 CCCCTTTGTTATTTTTGCCCGGG + Intergenic
1153362016 18:4207783-4207805 CCAGATTTGTATTTCTGTCCAGG + Intronic
1154023232 18:10683476-10683498 GCATTTTGATATTTTTGCACTGG + Intronic
1154134817 18:11767077-11767099 CCAGTTTGATATTTCTGCCCAGG + Intronic
1156561658 18:38132455-38132477 CCTCTGTGATGTTTCTGCCCTGG - Intergenic
1159684196 18:71396539-71396561 CCATTTTAATTTTTCTGTCCTGG + Intergenic
1164821471 19:31254472-31254494 CGTGTTTTATATTTCAGCCCCGG - Intergenic
927673923 2:25090911-25090933 GCAGTTTCATATTCCTGTCCCGG + Intronic
927696058 2:25240560-25240582 CTCCTTGGATATTTCTGCCCTGG - Intronic
928845909 2:35671617-35671639 CCAGTTTGGTGTTTTTGCTCAGG + Intergenic
929803555 2:45124907-45124929 CCAGTTTGATAGTCTTGTCCAGG - Intergenic
930545727 2:52765397-52765419 CCAGTTTTATATATATGTCCTGG - Intergenic
930658148 2:54027384-54027406 CCTGTTTGATATTTCTTCCCTGG - Intronic
931528150 2:63181390-63181412 CCAGTTTCATTCTTCTGCACAGG + Intronic
934136711 2:89002598-89002620 CCAGGCTGATATCTCTGTCCTGG + Intergenic
934755947 2:96824992-96825014 CCAGTTTGATTCATCTCCCCTGG - Intronic
939268110 2:139902173-139902195 CCAGTTTTACATTTCTACTCTGG - Intergenic
939724622 2:145701321-145701343 CCAGTTTGCTCTTTTTGCTCAGG + Intergenic
941576719 2:167241835-167241857 GCAGTTTGAAAAGTCTGCCCAGG + Exonic
942429154 2:175891194-175891216 CCAGTTTGAAATATCTACCTTGG + Intergenic
1169918553 20:10708419-10708441 CCAGTCTGTTATTTCTGCCCAGG + Intergenic
1170245947 20:14221428-14221450 CCAGTTTCATTTTTCTGCAGGGG - Intronic
1171227879 20:23456516-23456538 CCAGTTTTAAAATTCTGCCAAGG - Intergenic
1171383973 20:24754810-24754832 CCAGCTCGAAATCTCTGCCCCGG - Intergenic
1171806269 20:29683164-29683186 CCAGTTTTAAATTTTTGACCTGG + Intergenic
1171837789 20:30173248-30173270 CCAGTTTTAAATTTTTGACCTGG - Intergenic
1175457554 20:59126961-59126983 CCATGTTTATATTTCTGCCTGGG + Intergenic
1175670362 20:60897369-60897391 ACAGTTTGATATTTCCTCACAGG + Intergenic
1183031763 22:35111767-35111789 CCTGGCTGTTATTTCTGCCCTGG - Intergenic
1183211001 22:36451218-36451240 ACAGTTTGCTATTACTACCCAGG - Intergenic
950652835 3:14418231-14418253 CCCCTTAGAAATTTCTGCCCAGG - Intronic
952614499 3:35253555-35253577 CCAGTTTCAATTTTCTGCCTAGG - Intergenic
952690135 3:36195931-36195953 CCACTTTGATATACTTGCCCAGG - Intergenic
954771442 3:52973481-52973503 TCAGTTTGATTTTTCTGCCTGGG - Intronic
956868621 3:73394247-73394269 GCAGTTTGATATTTTTGCACGGG + Intronic
959325629 3:104933205-104933227 CCAGTGTGATATTACTGAACAGG - Intergenic
960968464 3:123122016-123122038 ACAGTCTGAGATTTCTGCACAGG - Intronic
961906383 3:130267026-130267048 CCAGTTTGGTATGTCTGGCTTGG + Intergenic
962822628 3:139066614-139066636 CCACTTTGTTCTTTCTGCTCAGG + Intronic
963415711 3:144993329-144993351 CCAGTTTCAATTTTCTGCCTAGG + Intergenic
964383170 3:156119070-156119092 CCTGTTTGATATTACTGTCCAGG - Intronic
965386301 3:168050192-168050214 CCAGTTTTACACTTCTGTCCAGG - Intronic
965571145 3:170175135-170175157 CCAGCTTGCTTTTTCTGTCCTGG - Intronic
967119981 3:186374171-186374193 CCAGTTTGACATTTTTTTCCTGG - Intergenic
968049817 3:195646930-195646952 CCAGTTTGATGTTCCTCCCTGGG - Intergenic
968097476 3:195941659-195941681 CCAGTTTGATGTTCCTCCCTGGG + Intergenic
968304318 3:197639052-197639074 CCAGTTTGATGTTCCTCCCTGGG + Intergenic
971698322 4:29934792-29934814 CCAGTTTCAGTTTTCTGCACAGG - Intergenic
973087137 4:46079147-46079169 CCTGTTACATATTTCTGCACAGG + Intronic
976564291 4:86535811-86535833 ACATTTTGAAATTTCAGCCCTGG - Intronic
976688231 4:87839748-87839770 TCAGTTTGATTTTTCTTCTCAGG - Intronic
977317754 4:95472096-95472118 CTTGTTTGATATTTCTTCACTGG - Intronic
978776305 4:112509986-112510008 CCAGTTTGATTTTTCCAGCCGGG - Intergenic
981182031 4:141757268-141757290 GCATTTTGATAATTCTTCCCAGG - Intergenic
983130272 4:164010813-164010835 CAAGTTTGTTATTTTTGCTCTGG - Intronic
985506566 5:284916-284938 CGAGTTTGATATTCCTCCCCGGG - Intronic
993518606 5:88869225-88869247 CTAGTTTTAGATTTCTGCCTAGG - Intronic
994234409 5:97344185-97344207 CCAGTTTGATATTAGTCTCCTGG - Intergenic
995767506 5:115634895-115634917 CCATTCTAATATTACTGCCCAGG + Intergenic
997955122 5:138273442-138273464 CCAGTCTGATTTGACTGCCCAGG - Intronic
999864314 5:155684283-155684305 CCAGGTTGTTATTTCAGCCTGGG + Intergenic
1000619302 5:163464953-163464975 CAAGTTTTACATTTCTGCCTAGG + Intronic
1000694317 5:164360942-164360964 CGAGTTTGCTATTTGTGCCTGGG - Intergenic
1000880067 5:166687050-166687072 CCAGTTAGATAGCTCAGCCCTGG + Intergenic
1001302085 5:170540913-170540935 CCAGTGTGCCATTTCTGCACTGG + Intronic
1001645374 5:173277749-173277771 CCACTTTGGGATTTCTGGCCAGG - Intergenic
1011633356 6:89348567-89348589 ACAGAGTGATGTTTCTGCCCAGG + Intronic
1013745696 6:113343635-113343657 CTAGAATGATTTTTCTGCCCAGG - Intergenic
1014390969 6:120863802-120863824 CTAGTTTCATTTTTCTGCACAGG - Intergenic
1014476615 6:121880987-121881009 GCTATTTGATATTACTGCCCAGG - Intergenic
1019184429 6:170212903-170212925 CCACTTTGCTATTCCTGCCAAGG - Intergenic
1020779991 7:12505814-12505836 CCAGTTGATTATTTCTGCCTGGG + Intergenic
1022505000 7:30904201-30904223 CCACTTTGATATATGTGTCCTGG - Intergenic
1023053954 7:36276952-36276974 CCATTTTGACCTTTCTGCCCTGG + Intronic
1024087121 7:45902851-45902873 ACAGTTTGGAATTTGTGCCCAGG + Intergenic
1024529483 7:50379474-50379496 TCAGTTTTATATTTCTGACTCGG + Intronic
1027524358 7:79247976-79247998 CCATTTTGTTATTTGTGTCCTGG - Intronic
1030966645 7:116001010-116001032 CCAGTATGTTATTTTTGCTCTGG - Intronic
1031562358 7:123254071-123254093 GCAGTTTGAATTTTCTCCCCAGG + Intergenic
1031570707 7:123355980-123356002 CCACTTTGTTCCTTCTGCCCTGG + Intergenic
1032954844 7:136959028-136959050 CTATTTTTATGTTTCTGCCCTGG + Intronic
1033003565 7:137535299-137535321 CCAATTTGATATCCCCGCCCTGG + Intronic
1033424741 7:141233842-141233864 ACTGTTTGACAATTCTGCCCTGG - Intronic
1039296342 8:36159906-36159928 CAAGTTTGAGATTTCTGGCTGGG + Intergenic
1040426628 8:47294293-47294315 GCACTTTGATATATCTGCACTGG - Intronic
1043235724 8:77863358-77863380 CCAGTTTGTTATTTTTGCTGAGG - Intergenic
1043755231 8:83995104-83995126 CCAGTTGGATATTTGTGGCCAGG - Intergenic
1045578365 8:103450546-103450568 CCAATTGGATGTTCCTGCCCAGG + Intergenic
1050391711 9:5150041-5150063 CCAGATTGATTCTTCTGCACAGG - Intronic
1053398060 9:37792839-37792861 TAAGTTTGACATTTCTGACCGGG - Intronic
1057060064 9:91995839-91995861 CCTGTTTGATCGTTTTGCCCTGG - Intergenic
1057803588 9:98204881-98204903 TCAGTTAGTTATGTCTGCCCTGG - Intronic
1058430909 9:104918388-104918410 CCACTTTGATAGTTTTGTCCTGG - Intronic
1058864114 9:109145611-109145633 CAAGTTTGATTTTTCTGCCTCGG - Intronic
1059189347 9:112309294-112309316 CCAGTATGAGTTTTCTGTCCTGG - Intronic
1059634407 9:116157240-116157262 CCGGGATGCTATTTCTGCCCCGG + Intronic
1188442928 X:30230897-30230919 CCAGTTTTATAGCTCTGCCTAGG - Intronic
1188443156 X:30232199-30232221 CCAGTTTTATAGTTCCGCCTAGG - Intronic
1189379328 X:40490851-40490873 CCAGTTTGAGATCTGAGCCCTGG + Intergenic
1190054237 X:47172652-47172674 CCAGTTTGACATTTATGTCATGG + Intronic
1190219350 X:48501009-48501031 CCAGTTTGATATCACTTCCCAGG - Intergenic
1190621372 X:52289763-52289785 CTAGTTTCATTTTTCTGCACTGG + Intergenic
1191085123 X:56558270-56558292 CCAGTTTGTAATTTGTGTCCTGG + Intergenic
1197971683 X:132120968-132120990 CCAGGATGATCTTTCTGACCTGG + Intronic
1198309815 X:135420198-135420220 GCAATTTGATATATCTGCCCTGG + Intergenic