ID: 1154138306

View in Genome Browser
Species Human (GRCh38)
Location 18:11800479-11800501
Sequence AACTGCTTCTTGGCACTTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 131}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154138306_1154138309 -9 Left 1154138306 18:11800479-11800501 CCTGTAAGTGCCAAGAAGCAGTT 0: 1
1: 0
2: 2
3: 9
4: 131
Right 1154138309 18:11800493-11800515 GAAGCAGTTTATTGTTGTGTGGG 0: 1
1: 0
2: 2
3: 13
4: 156
1154138306_1154138313 16 Left 1154138306 18:11800479-11800501 CCTGTAAGTGCCAAGAAGCAGTT 0: 1
1: 0
2: 2
3: 9
4: 131
Right 1154138313 18:11800518-11800540 CAGCATTTGCTGGGAAAAGGAGG 0: 1
1: 0
2: 3
3: 35
4: 271
1154138306_1154138310 6 Left 1154138306 18:11800479-11800501 CCTGTAAGTGCCAAGAAGCAGTT 0: 1
1: 0
2: 2
3: 9
4: 131
Right 1154138310 18:11800508-11800530 TGTGTGGGAGCAGCATTTGCTGG 0: 1
1: 0
2: 3
3: 18
4: 190
1154138306_1154138308 -10 Left 1154138306 18:11800479-11800501 CCTGTAAGTGCCAAGAAGCAGTT 0: 1
1: 0
2: 2
3: 9
4: 131
Right 1154138308 18:11800492-11800514 AGAAGCAGTTTATTGTTGTGTGG 0: 1
1: 0
2: 2
3: 14
4: 197
1154138306_1154138311 7 Left 1154138306 18:11800479-11800501 CCTGTAAGTGCCAAGAAGCAGTT 0: 1
1: 0
2: 2
3: 9
4: 131
Right 1154138311 18:11800509-11800531 GTGTGGGAGCAGCATTTGCTGGG 0: 1
1: 0
2: 0
3: 30
4: 190
1154138306_1154138312 13 Left 1154138306 18:11800479-11800501 CCTGTAAGTGCCAAGAAGCAGTT 0: 1
1: 0
2: 2
3: 9
4: 131
Right 1154138312 18:11800515-11800537 GAGCAGCATTTGCTGGGAAAAGG 0: 1
1: 0
2: 1
3: 36
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154138306 Original CRISPR AACTGCTTCTTGGCACTTAC AGG (reversed) Intronic
902637545 1:17744461-17744483 AACTGCTTATGAGCACCTACTGG - Intergenic
903810367 1:26031708-26031730 AACAGAATCTTGGGACTTACAGG - Intronic
906448525 1:45923339-45923361 GACTGCTTCATGGCAGTGACGGG + Intronic
906887268 1:49662975-49662997 TGATGCTTCTTGGCACATACTGG + Intronic
907557197 1:55354397-55354419 ATCTGCTGCTTGGCACTGGCTGG + Intergenic
907944916 1:59127041-59127063 TACTGCATCTTCTCACTTACAGG + Intergenic
907974592 1:59419176-59419198 GACGGCTTCTTGCCACTTAGAGG - Intronic
910850693 1:91647359-91647381 AAATGATTCCTGTCACTTACAGG + Intergenic
911143269 1:94528478-94528500 AAAAGGTTCTTGGCACCTACTGG - Intergenic
912040028 1:105378257-105378279 AATTGCTTCTGGGGACTTAATGG + Intergenic
913216210 1:116623010-116623032 AAGTGCTTCATGGAACTTAAAGG + Intronic
913407209 1:118507965-118507987 AAGTGCTTCTTAGGACATACAGG - Intergenic
915678150 1:157551196-157551218 AACTTCATCTTGCCACCTACTGG - Intronic
917758635 1:178131160-178131182 AAAAGGGTCTTGGCACTTACTGG - Intronic
919233318 1:194804686-194804708 AATTGCTCCTAGACACTTACTGG - Intergenic
919708753 1:200705139-200705161 AACTGCTTCTTTTGACTTGCTGG - Intergenic
921660462 1:217795165-217795187 AATGGATTTTTGGCACTTACAGG + Intronic
924262179 1:242243303-242243325 AACTCCTTCTTGGAACTCAGAGG + Intronic
1063072302 10:2679307-2679329 AATTGCTTCTTGTCACTTGGAGG - Intergenic
1063942733 10:11147206-11147228 AACTGCTACTTGGTATTTTCAGG + Intronic
1068532788 10:58208562-58208584 AACTGATTCTTGGTACTTGTAGG + Intronic
1068633633 10:59324002-59324024 CACTGTTTCTTGGCACTTGAAGG + Exonic
1068904378 10:62306982-62307004 AACTGCTTCTGGGCACCAGCAGG + Intergenic
1070935654 10:80292956-80292978 AACTGCTCAGTGGGACTTACAGG - Intergenic
1071428405 10:85582663-85582685 AAGTGCTTCTGGGCACTGTCAGG + Intergenic
1071958091 10:90780641-90780663 CACTGTTTCTTGGCACTCTCTGG - Intronic
1075816287 10:125267011-125267033 AACTGCTTCTTGAGGCTTCCAGG + Intergenic
1078151729 11:8765290-8765312 AAGTGCTACTTGGCAGTTTCAGG + Intronic
1084087490 11:66861253-66861275 ATCTGCTTCTAGGCACTGGCTGG + Intronic
1084875104 11:72125283-72125305 AACTGTTTCTTCTCACTTAGAGG - Intronic
1085373742 11:76038709-76038731 TACTGCTTCTTGGCTCTCAAGGG - Intronic
1093856757 12:24113744-24113766 AGCCGCTTCTTGGCTCTTGCAGG - Intergenic
1094123975 12:27003216-27003238 AAATAATTCTTTGCACTTACCGG + Exonic
1095177667 12:39111745-39111767 AACTGCTGCTTGGACCTGACAGG - Intergenic
1100632759 12:96404962-96404984 AACTGAATCTTGGCAGTTAAGGG + Intergenic
1102020972 12:109682631-109682653 AACGGATTTTTGGCAATTACTGG - Intergenic
1105219944 13:18316485-18316507 AAGTGCTTCATGGAACTTAAAGG + Intergenic
1105692326 13:22853754-22853776 AAATGCTTCTTGCCAATTTCTGG + Intergenic
1107067345 13:36228944-36228966 CATTGCTTCTTTGCACTGACTGG + Intronic
1109222426 13:59653767-59653789 ATCTGCTTCTTGTCTCTTACTGG + Intergenic
1111659912 13:91196285-91196307 AACTGCTTCTGTGCATTTTCAGG - Intergenic
1114963536 14:27926683-27926705 CACTGCTTCTAGGCCCTTATAGG - Intergenic
1118236698 14:64011824-64011846 AACTTCTTCTTGTCACCTCCAGG + Intronic
1118265821 14:64294256-64294278 AACTGCCTCTTGAAACTTGCAGG - Exonic
1119116771 14:72029695-72029717 AAATGCTTCTTGTCACATGCAGG - Intronic
1119942350 14:78654777-78654799 GAATGGTTCTTGGCACTTAGTGG + Intronic
1126346460 15:47699774-47699796 TACTGCTTTTTGACACATACTGG + Intronic
1128402146 15:67294454-67294476 GACTGCTGCTTGGTACTAACTGG - Intronic
1129922869 15:79335389-79335411 AACTATTTCTTGACATTTACTGG + Intronic
1130056437 15:80530355-80530377 TACTGCTTGCTGGGACTTACTGG + Intronic
1130150306 15:81306607-81306629 AAAGGCTTCTGGGCACTTTCTGG + Intronic
1130231798 15:82102921-82102943 CCCTGCTTCTTGGCAGTTGCAGG + Intergenic
1131378692 15:91946391-91946413 CACTGGTTCTTGGCACTGCCTGG - Intronic
1131948592 15:97655011-97655033 ATTTTCTTCTTGGCACTTAATGG - Intergenic
1135048811 16:19175831-19175853 AACTGATGATTGGCACTTTCAGG - Intronic
1138898986 16:61245345-61245367 AACTGGTTAGTGGCACTGACTGG + Intergenic
1141207881 16:81947599-81947621 AACTCCATCTTAGCCCTTACTGG - Intronic
1143206166 17:5140495-5140517 CACTGCTTCTTGGAACTCATGGG - Intronic
1152214111 17:79022590-79022612 AACTTCCTCATGTCACTTACAGG + Intergenic
1154138306 18:11800479-11800501 AACTGCTTCTTGGCACTTACAGG - Intronic
1156492607 18:37505263-37505285 GACTGCTTCTTGGAAGCTACAGG - Intronic
1158422777 18:57310908-57310930 GACTGCTTCCTGGAAGTTACTGG + Intergenic
1161032498 19:2064662-2064684 AACTGCTTCTTGTCAGACACAGG - Intergenic
1164803847 19:31100651-31100673 AACTGCTTCTTGGCACATTGGGG - Intergenic
1165002868 19:32779344-32779366 AACCGCTTACTGGTACTTACAGG - Intronic
926001563 2:9337632-9337654 AACTGATGCTTGGGATTTACAGG - Intronic
927420610 2:22926609-22926631 AGCTGCTGCTTGTGACTTACAGG - Intergenic
929291783 2:40200638-40200660 GACTGCTTGTTGGCATTTTCAGG - Intronic
934184100 2:89656031-89656053 AAGTGCTTCATGGAACTTAAAGG - Intergenic
934294390 2:91730168-91730190 AAGTGCTTCATGGAACTTAAAGG - Intergenic
939973888 2:148694259-148694281 AACTCCTTCTCGGCACTTTTTGG - Intronic
941728885 2:168893587-168893609 AACTGGTTTTTGTCAATTACTGG + Intronic
943205616 2:184890470-184890492 AAATGCTTCTTGGAACTGAATGG + Intronic
943257155 2:185610408-185610430 TACTGATTCTTGGCACTTGCTGG + Intergenic
945396403 2:209324275-209324297 AACTTCTTGTTGGCCCTTCCTGG - Intergenic
1170778937 20:19406013-19406035 AATTGCTTCATGGAACTTGCTGG + Intronic
1172442014 20:34972374-34972396 ACCGGCTTCTTGGCACTCTCTGG + Intergenic
1174190470 20:48736870-48736892 AACTTCTCCTTGGCACTTACAGG - Intronic
1180817555 22:18801376-18801398 AAGTGCTTCATGGAACTTAAAGG + Intergenic
1181203744 22:21235696-21235718 AAGTGCTTCATGGAACTTAAAGG + Intergenic
1203223176 22_KI270731v1_random:59718-59740 AAGTGCTTCATGGAACTTAAAGG - Intergenic
1203267653 22_KI270734v1_random:27102-27124 AAGTGCTTCATGGAACTTAAAGG + Intergenic
950260797 3:11542470-11542492 ATTTGCTTCTTAGCACTTCCTGG + Intronic
952347196 3:32499298-32499320 ATCTGTTTCTTGGTACTTATAGG + Intronic
953879321 3:46683465-46683487 AACTGCTTCTTGCTACTCTCTGG + Intronic
957554724 3:81751472-81751494 AACTGGTTCTTCCCATTTACAGG - Intronic
959466620 3:106695435-106695457 AAGTGGTTTTTGTCACTTACAGG - Intergenic
963700930 3:148625969-148625991 TACTAGTTCTTGGTACTTACTGG - Intergenic
965710963 3:171556005-171556027 CAGTACTTTTTGGCACTTACAGG + Intergenic
968255394 3:197265391-197265413 AACTTTTTCTGGGCATTTACAGG - Intronic
969928360 4:10606870-10606892 AACAGCTTCTTGACAGATACAGG + Intronic
970509358 4:16765391-16765413 AACTGCATCTTGGCATTTGCTGG - Intronic
974203949 4:58675226-58675248 AACTGCTTCTTGCCAATAAGGGG - Intergenic
974405386 4:61461252-61461274 AACTGTTTGTTGGTACTAACTGG - Intronic
976676542 4:87709912-87709934 AACTGCTTCTTATCAGTCACTGG - Intergenic
978386341 4:108179353-108179375 AACTGCTTCTTGGTACACATGGG + Intergenic
980121169 4:128729996-128730018 GTCTGCTTCTTGGGACTTACAGG - Intergenic
980240977 4:130175160-130175182 AACTGGTGCTTGGCACTTAGTGG - Intergenic
981490153 4:145331011-145331033 AACTGCTTCTAAGCATTTATTGG + Intergenic
986374281 5:7114389-7114411 TACTGCATGTTTGCACTTACAGG - Intergenic
987885111 5:23802511-23802533 ATCTTCATCTTGGCAATTACAGG - Intergenic
992463994 5:76986022-76986044 AACTTCTTGTAGGCACCTACAGG + Intergenic
994044549 5:95293283-95293305 ACCTGCCTCTTGTCTCTTACTGG + Intergenic
996291139 5:121853175-121853197 TACTGCTTCTTGGGACACACTGG - Intergenic
998493257 5:142565195-142565217 TACTGCTTCTGGGCACTTACCGG - Intergenic
999408883 5:151332731-151332753 ACATGCTTCTTGAAACTTACAGG + Intronic
999924381 5:156359275-156359297 AACTGTATCTGGCCACTTACAGG + Intronic
1000870269 5:166568465-166568487 ATCTGCTTTGTCGCACTTACTGG - Intergenic
1002408712 5:179056254-179056276 AAATTCTTGTTTGCACTTACAGG + Intergenic
1002517375 5:179769281-179769303 AGCTGCTTCGTGTCACTTAGTGG + Intronic
1002842383 6:917483-917505 AACTGATGCTTGGCACTTTCAGG - Intergenic
1003970022 6:11290457-11290479 AAATGCTTCTTGGCTCCTAAGGG - Intronic
1004668216 6:17769447-17769469 AACTGCTGCTTGAGACTTCCTGG + Intronic
1005087716 6:22023882-22023904 GATTGCTTCTTTTCACTTACTGG + Intergenic
1016892310 6:149018885-149018907 AACTGCATCTCTGCACTTCCTGG - Intronic
1017528008 6:155259693-155259715 AACAGCTTCTTGGCTCTTTCTGG + Intronic
1019191598 6:170254386-170254408 ACCTGGTTCTTGGCACACACTGG - Intergenic
1019470245 7:1215955-1215977 AACTGCTCCATGGCACTGTCGGG - Intergenic
1023254469 7:38299477-38299499 AACTGCACCTTGCTACTTACTGG + Intergenic
1025142071 7:56474897-56474919 CACAGCATCTTGGCACTCACAGG - Intergenic
1028550721 7:92061333-92061355 AAGTTCCTCTTGGCACTTAAGGG - Exonic
1031632013 7:124054883-124054905 AACTGCTTCTAGGTCCTTTCAGG - Intergenic
1034231735 7:149534926-149534948 AACTGTTTCTTCTCACTTAGAGG + Intergenic
1035057212 7:156043649-156043671 AATTGCTGCTTGACACTTGCTGG - Intergenic
1035710296 8:1708626-1708648 CACTGCTTCCTGGCAGTTGCAGG - Intergenic
1037969585 8:23162778-23162800 AACCGCTTCCTGCCACTTTCAGG + Intronic
1041868195 8:62600898-62600920 AATTGTTCCTTTGCACTTACTGG + Intronic
1047618925 8:126586657-126586679 ACCTGCATCTTGGCACTTTGAGG - Intergenic
1050664366 9:7918791-7918813 AACAGCATCTTGGCACTGTCTGG + Intergenic
1052528806 9:29655924-29655946 AACTGACTCATGGCTCTTACTGG + Intergenic
1055178791 9:73356480-73356502 TACTAGTTCTTGCCACTTACTGG - Intergenic
1059331907 9:113541045-113541067 AACTGCTCCATGTCACTTCCTGG + Intronic
1059994704 9:119897391-119897413 ATCTGCTTCTTGACACCTATGGG + Intergenic
1186112132 X:6269625-6269647 ATCTGCATTTTGGTACTTACGGG + Intergenic
1187144998 X:16629295-16629317 TACTGCTTCTTGCCTTTTACTGG - Intronic
1191249978 X:58255672-58255694 AACTGCTTCTTGACACTATGGGG - Intergenic
1192779862 X:74283053-74283075 AACTGCTCCTTGGGACTTCCAGG - Intergenic
1193485227 X:82078839-82078861 CACGACTTCTTTGCACTTACAGG + Intergenic
1194567618 X:95512180-95512202 ACCTGCATCTCAGCACTTACAGG + Intergenic
1198389635 X:136161233-136161255 ACCTGCTTCTTGCCACCTATTGG + Intronic
1200825407 Y:7633435-7633457 AACAGTTTATGGGCACTTACTGG + Intergenic
1201570071 Y:15404153-15404175 AACTGGTTCATGGCTCATACTGG - Intergenic
1202193241 Y:22266752-22266774 AACAGTTTCTGGGCACTTGCTGG + Intergenic