ID: 1154140839

View in Genome Browser
Species Human (GRCh38)
Location 18:11822696-11822718
Sequence ACCGTGTGGGCTCACTTCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 75
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 64}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154140834_1154140839 5 Left 1154140834 18:11822668-11822690 CCACATGCCTGTTAGCTCTGGGG 0: 1
1: 0
2: 0
3: 17
4: 157
Right 1154140839 18:11822696-11822718 ACCGTGTGGGCTCACTTCCATGG 0: 1
1: 0
2: 0
3: 10
4: 64
1154140829_1154140839 24 Left 1154140829 18:11822649-11822671 CCCTCTCACTGACCTCTAGCCAC 0: 1
1: 0
2: 2
3: 38
4: 315
Right 1154140839 18:11822696-11822718 ACCGTGTGGGCTCACTTCCATGG 0: 1
1: 0
2: 0
3: 10
4: 64
1154140836_1154140839 -2 Left 1154140836 18:11822675-11822697 CCTGTTAGCTCTGGGGTCAGCAC 0: 1
1: 0
2: 0
3: 8
4: 131
Right 1154140839 18:11822696-11822718 ACCGTGTGGGCTCACTTCCATGG 0: 1
1: 0
2: 0
3: 10
4: 64
1154140830_1154140839 23 Left 1154140830 18:11822650-11822672 CCTCTCACTGACCTCTAGCCACA 0: 1
1: 0
2: 2
3: 26
4: 307
Right 1154140839 18:11822696-11822718 ACCGTGTGGGCTCACTTCCATGG 0: 1
1: 0
2: 0
3: 10
4: 64
1154140831_1154140839 12 Left 1154140831 18:11822661-11822683 CCTCTAGCCACATGCCTGTTAGC 0: 1
1: 0
2: 1
3: 7
4: 109
Right 1154140839 18:11822696-11822718 ACCGTGTGGGCTCACTTCCATGG 0: 1
1: 0
2: 0
3: 10
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154140839 Original CRISPR ACCGTGTGGGCTCACTTCCA TGG Intronic
907421255 1:54348802-54348824 GCCCTGTGAACTCACTTCCAAGG - Intronic
908676598 1:66611489-66611511 ACCATGTGGCCTCACCTACATGG - Intronic
910480100 1:87649399-87649421 ATCGTATGGGCCCACTTCCACGG + Intergenic
911327334 1:96483596-96483618 TCCGCTTGGGCTCAATTCCAGGG - Intergenic
1075741991 10:124701614-124701636 AACGTCTGGGCTGCCTTCCAGGG + Intronic
1080949468 11:37013995-37014017 CTGGTGTGTGCTCACTTCCAGGG + Intergenic
1084424190 11:69075694-69075716 CCCGTGTGGGGTCACTGCCTGGG + Intronic
1086014431 11:82149558-82149580 AGCATCTGGGCTCACTCCCATGG + Intergenic
1091367018 11:135030815-135030837 AGCGTGTGGGCTGGCATCCACGG + Intergenic
1091489058 12:917119-917141 ACTGTGTGTGCTCATTTCCGTGG - Intronic
1098986054 12:77013600-77013622 ACTGTGTGGGTCCACTTACACGG + Intergenic
1102844248 12:116161585-116161607 AGCTTGTGGGCTCACTTTGACGG - Intronic
1110364324 13:74664251-74664273 ACTATTTGGGCTCACTTGCAGGG + Intergenic
1113522454 13:110950496-110950518 ACTGTGTGGGCTGACTTCCTGGG + Intergenic
1113931742 13:113972427-113972449 ACCGGGCTGTCTCACTTCCACGG + Intergenic
1117307783 14:54493305-54493327 ACCGTGTGTGCGCACTTCCCAGG - Intergenic
1119859639 14:77926865-77926887 TCAGGGTGGGCTCCCTTCCAGGG + Intronic
1122859058 14:104574109-104574131 ACGGAGTGGGCTCAGATCCAGGG - Intronic
1126365181 15:47886733-47886755 ACTGTGTGTGCTCAATTCCCAGG + Intergenic
1127178069 15:56382702-56382724 ACCCTGTTGGCTGTCTTCCATGG + Intronic
1133719787 16:8484169-8484191 AGGGTTTGGGCTCTCTTCCAAGG - Intergenic
1137956410 16:52835233-52835255 ACTGTGTGGGCTTCCTTCCCAGG + Intergenic
1140047975 16:71455011-71455033 ACCATGGGGGCTCACTGGCAGGG + Intronic
1140719556 16:77758969-77758991 ACCCTGTGGGGTCTCTTACAGGG + Intergenic
1146282663 17:31555122-31555144 ACTGTGTGACCTCACTTCCCAGG + Intergenic
1148331109 17:46814523-46814545 ACCGGGTGGTCTCCCTTCCAGGG - Intronic
1149533930 17:57417352-57417374 ATGGAGAGGGCTCACTTCCATGG + Intronic
1149913636 17:60588414-60588436 AACGTGTGTCCTCACTACCAAGG + Intergenic
1153934369 18:9907832-9907854 ACTGTGTGGGTCCACTTACAGGG - Intergenic
1154140839 18:11822696-11822718 ACCGTGTGGGCTCACTTCCATGG + Intronic
1156248887 18:35331818-35331840 ACCCTGTGGGCTCTTTTCTATGG - Intergenic
1156450006 18:37261520-37261542 AGCGTGTGGGCTCACTGTCCAGG - Intronic
1159184205 18:64948367-64948389 ACAGTCTGGGCTTACTTCCTTGG + Intergenic
1160728270 19:628277-628299 ACAGTGTGGGCTCTCTGCCCAGG + Intronic
1164829007 19:31306149-31306171 ACCGTGTGCGCTCATTCCCGGGG + Intronic
1167623435 19:50571060-50571082 ACCTTGAGGGGTCAGTTCCACGG - Intergenic
938791074 2:134676651-134676673 ACCGTGAGAGGTCACTTCCAAGG - Intronic
942523853 2:176832142-176832164 AACGTCTGGTCTCATTTCCATGG - Intergenic
947649580 2:231774429-231774451 AGAGTATGGGCTCACTTCCAAGG - Intronic
948673243 2:239581929-239581951 ACCCTGTGAGCTCCTTTCCAGGG - Intronic
1170493200 20:16899162-16899184 CCTCTGTGGGCTCACGTCCAGGG + Intergenic
1173911260 20:46672657-46672679 GCCGTATCGGGTCACTTCCACGG - Intronic
1174629857 20:51946786-51946808 CCCTGGTGGGCTCACATCCAAGG + Intergenic
1181777296 22:25168902-25168924 AATGTGGGGGCTCACTTTCAAGG + Intronic
954082791 3:48222279-48222301 AGCGTGTGGGGTCACCTCCTGGG - Intergenic
960403171 3:117228820-117228842 CCAGAGAGGGCTCACTTCCAGGG - Intergenic
978838649 4:113183738-113183760 ACCTTATCCGCTCACTTCCATGG - Intronic
981698629 4:147583843-147583865 ACTTTGTGGGCTCACTCCTAAGG + Intergenic
983976023 4:173935432-173935454 AGCTTGTGGGCTCTATTCCATGG + Intergenic
985756955 5:1724982-1725004 ACCCGGTGGGCTGCCTTCCAAGG - Intergenic
986728796 5:10619660-10619682 AGCGTGAGGCATCACTTCCATGG + Intronic
988966388 5:36422565-36422587 AGCATGTGGGCCCAATTCCAGGG + Intergenic
996118969 5:119649540-119649562 ACCTTGTGGGCTCACCTCAAAGG + Intergenic
997076167 5:130680311-130680333 ACCGTGTGTTCTCACTTTCAAGG - Intergenic
997234468 5:132264829-132264851 ACCCTGTGCTCTCACTCCCAGGG + Intronic
1002284589 5:178153842-178153864 ACCGCGTGGGCTCGCCTCCCTGG - Exonic
1002304070 5:178273191-178273213 ACAGCCTGGGCTCCCTTCCACGG - Intronic
1004335278 6:14758657-14758679 ACAGTGTGGGCTACCTTCCAGGG + Intergenic
1010550254 6:77212987-77213009 AGCCTGTGGGCTCAGTACCACGG - Intergenic
1011270564 6:85575094-85575116 TCTGTGTGAGCACACTTCCAAGG + Intronic
1011353131 6:86445091-86445113 ACTGCGTGTGCTCACTTCCCAGG - Intergenic
1016408854 6:143760658-143760680 GCCCTGTGGGGTCACTTCTAGGG + Intronic
1016918228 6:149264911-149264933 ACCGTGTGGCCACGTTTCCAGGG + Intronic
1018772607 6:166985111-166985133 TCCGTGGTGGCTCACTTACATGG + Intergenic
1019571288 7:1713680-1713702 AGGGTCTGGGCTCACCTCCATGG - Intronic
1029092770 7:98061185-98061207 ACTGTGTGATCTCACTTACATGG - Intergenic
1029270954 7:99376143-99376165 ACAGTCTTGGCTCACTGCCAAGG - Intronic
1034819888 7:154206872-154206894 TGCGTATGGGGTCACTTCCAAGG + Intronic
1056536091 9:87529022-87529044 ACTGTGTGTGCTCACCTCCCAGG + Intronic
1057259323 9:93575580-93575602 ACCGTGGGGGCTCAGTTCCCTGG + Intergenic
1058396205 9:104557075-104557097 AAAGTCTGGTCTCACTTCCACGG - Intergenic
1058647511 9:107144311-107144333 TAAGTGTGTGCTCACTTCCAGGG - Intergenic
1061427868 9:130511784-130511806 CCCGTGTAGTCTCACTTTCATGG - Intergenic
1185456729 X:314444-314466 ACCGTGTGGGCTCTCTCTCCGGG - Intronic
1201922840 Y:19253257-19253279 ACTGTGTGTGCTAAATTCCAAGG - Intergenic