ID: 1154144172

View in Genome Browser
Species Human (GRCh38)
Location 18:11852421-11852443
Sequence CAGAATGATCAGATTGAAGG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 225
Summary {0: 1, 1: 1, 2: 0, 3: 15, 4: 208}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154144172 Original CRISPR CAGAATGATCAGATTGAAGG TGG Exonic
900640128 1:3684551-3684573 CAGAACGAACAGAGTGAAGCGGG + Intronic
901522609 1:9796863-9796885 CAGAATGAACAGATGGAATGTGG + Intronic
902367083 1:15983037-15983059 CAGCCTGGTCAGATGGAAGGAGG - Intergenic
902933544 1:19747696-19747718 CAAAATGATCATTTTGAAGATGG + Intronic
903339940 1:22647450-22647472 CAGCCTGATCAGATTCAACGCGG + Exonic
904375000 1:30075217-30075239 CTGATTGATCAGGTTGAAGATGG - Intergenic
904806783 1:33137773-33137795 CAGAATGATGAGACTGAGGAAGG - Intergenic
905545058 1:38791164-38791186 CTGGATGATCAGATTGTAAGGGG - Intergenic
905916572 1:41688740-41688762 CAGAATGATCAGAGGAGAGGTGG - Intronic
906653161 1:47527840-47527862 CAGAATGAGCAGACTCTAGGGGG + Intergenic
907534101 1:55133375-55133397 CGCAATGATCAGATTCAAAGAGG + Intronic
907671816 1:56481049-56481071 CAGGAAGATCATATTGAAGCAGG + Intergenic
909030901 1:70538397-70538419 AAGAATGATTAGATAGAAGTGGG - Intergenic
909446040 1:75750129-75750151 CAGGATGATCATATTTAGGGTGG - Intronic
911109778 1:94170520-94170542 CAAAATCAGCAGATTGAATGTGG + Intronic
912025147 1:105160392-105160414 CAACTTGATTAGATTGAAGGAGG - Intergenic
916409850 1:164535779-164535801 CATGATGCTCAGACTGAAGGAGG + Intergenic
916644146 1:166765469-166765491 AAGAATGATCTCATTGAAAGGGG + Intergenic
920793517 1:209115497-209115519 CAGGATGATCAGATAGCATGGGG + Intergenic
921696744 1:218220141-218220163 CAGAAAGATTAGAATAAAGGTGG - Intergenic
923216797 1:231856116-231856138 AAGAATGATCAGATGGGAGATGG + Intronic
923480329 1:234377640-234377662 CAGAAGGATCAGAGTGAAGCTGG - Intronic
924804655 1:247352739-247352761 CAGGCTTTTCAGATTGAAGGTGG - Intergenic
1066484776 10:35832900-35832922 CTGAATGAACTGAATGAAGGAGG + Intergenic
1067235033 10:44439862-44439884 CAGAAACATCAGATGGAAGCTGG - Intergenic
1067251196 10:44588293-44588315 CAGAAAAATAAGAGTGAAGGAGG + Intergenic
1067305377 10:45059443-45059465 CTGAATGAACTGACTGAAGGAGG + Intergenic
1068199773 10:53767983-53768005 CAGGAGGAACAGAGTGAAGGGGG + Intergenic
1072621423 10:97081897-97081919 CAGATGGGTCAGGTTGAAGGTGG - Intronic
1073523328 10:104155519-104155541 CATAATGGTCATCTTGAAGGGGG + Intronic
1081050848 11:38339163-38339185 CTGAATGTTGAGATTGAAGCAGG - Intergenic
1081800763 11:45857676-45857698 CAGAAGAATTATATTGAAGGAGG + Intronic
1081824841 11:46039298-46039320 GAGAATCAGCAGATTGAAAGTGG - Intronic
1081948908 11:47025417-47025439 CAAAATAATAAAATTGAAGGGGG - Intronic
1085320515 11:75571242-75571264 CAGAATAATCAGATGCAGGGGGG - Intronic
1090592435 11:128286808-128286830 CAGAGTGATGTGACTGAAGGTGG - Intergenic
1093314728 12:17634148-17634170 CAGAACAAACAGAATGAAGGGGG - Intergenic
1096128754 12:49140291-49140313 AAGAATGATCACATTTAAAGTGG + Intergenic
1099645178 12:85343937-85343959 CAGAAGGATCAGTTTAAAAGAGG - Intergenic
1099725522 12:86422101-86422123 CAGAATGATGAAAATCAAGGGGG + Intronic
1100289117 12:93197261-93197283 CTGAGTGATCAGATTCAAAGAGG + Intergenic
1102952602 12:117040547-117040569 CAGAATGAAGAGCTAGAAGGTGG - Intronic
1103650104 12:122425230-122425252 CAGAATGTAAATATTGAAGGAGG - Intergenic
1103834397 12:123807585-123807607 AGGAAAGATGAGATTGAAGGAGG + Intronic
1103965126 12:124633904-124633926 ATGAATGCTCAGAATGAAGGTGG + Intergenic
1104509173 12:129360583-129360605 CTGGGTGATCAGATGGAAGGTGG - Intronic
1106668827 13:31882985-31883007 GAGAATGAGCTGAGTGAAGGGGG - Intergenic
1109624479 13:64957683-64957705 CAGAATGATTTTATTGAAGGGGG - Intergenic
1110734371 13:78918695-78918717 GAGAATGAATGGATTGAAGGGGG - Intergenic
1112484547 13:99808705-99808727 TAGAATGATAACATTGGAGGTGG + Intronic
1112640764 13:101272633-101272655 AAGAAGGATCAGATTGAATTTGG + Intronic
1114445325 14:22783836-22783858 CAGAAGGCTCAGTTTGAATGAGG + Intronic
1115264861 14:31490792-31490814 GAGAGTGATCGGCTTGAAGGTGG + Intronic
1117263213 14:54058167-54058189 CAGTCTGCTCAGATTGATGGTGG + Intergenic
1117633665 14:57720620-57720642 CAGCTTGATTGGATTGAAGGAGG + Intronic
1118433303 14:65744733-65744755 CAGAATGGTCAGATTTTGGGGGG + Intergenic
1119862208 14:77944379-77944401 CAGAATAATCTGATGGCAGGAGG + Intergenic
1120124132 14:80720217-80720239 CATAATGCTCAAGTTGAAGGGGG + Intronic
1121281730 14:92703926-92703948 CAGAATGATTTTATTGAAGAGGG - Exonic
1122800110 14:104225170-104225192 GAGACTGCTCAGAGTGAAGGTGG + Intergenic
1123100374 14:105793619-105793641 CAGAATGAGCAGATAAAAAGAGG + Intergenic
1124904843 15:33858665-33858687 CAGCAGGATCAGGTTGGAGGTGG + Intronic
1127523874 15:59772994-59773016 CAGAATGAAGAGGTTGAATGAGG - Intergenic
1127536166 15:59891857-59891879 CAGAATTAGGACATTGAAGGAGG + Intergenic
1128907192 15:71477678-71477700 GAGAATGGTCAGCATGAAGGTGG - Intronic
1130066357 15:80608211-80608233 CAACTTGATCAGATTGAAGAAGG + Intergenic
1130241206 15:82193897-82193919 CAGAATGAGGAGAGTGAAGGCGG - Intronic
1130459222 15:84147262-84147284 CAGAATGAGGAGAGTGAAGGCGG + Intergenic
1132751584 16:1460142-1460164 CAGAGTGAGGAGATGGAAGGAGG + Intronic
1135809775 16:25576623-25576645 CAGATTGGTCAGATTGGAGATGG + Intergenic
1136094258 16:27943343-27943365 TAGAATGAACAAATAGAAGGTGG + Intronic
1138141027 16:54568644-54568666 CAGAATGGCCTCATTGAAGGTGG + Intergenic
1138306310 16:55979081-55979103 CAGAATGGTCTGATTTAATGAGG - Intergenic
1139812405 16:69632937-69632959 CAGTATAATAAGATAGAAGGAGG - Intronic
1140226290 16:73079991-73080013 CAGAAAGATCAGACTGAGAGAGG - Intergenic
1142520435 17:500810-500832 GAGAAAAATCAGATTAAAGGAGG - Intergenic
1143377301 17:6474344-6474366 CAGAATGAGGAGAGTGAAGTCGG - Intronic
1143581721 17:7831478-7831500 CAGAAGGACCACATTGAGGGGGG - Exonic
1146734351 17:35224921-35224943 CAGACAGATCAGACTGAAGAAGG - Intergenic
1148024627 17:44578073-44578095 GAGATTGAAAAGATTGAAGGAGG - Intergenic
1149417895 17:56479466-56479488 CAGTATGCCCAGATTGAAGTAGG + Intronic
1153029590 18:701342-701364 CAGAATGTTGATAATGAAGGAGG + Intronic
1153726219 18:7958259-7958281 CAAAATGCCCATATTGAAGGAGG + Intronic
1154144172 18:11852421-11852443 CAGAATGATCAGATTGAAGGTGG + Exonic
1155141303 18:23047014-23047036 CTGAATGATCAGAAAAAAGGGGG + Intergenic
1156253276 18:35372604-35372626 CAGGATGATCATCTAGAAGGAGG + Intronic
1159910619 18:74142251-74142273 TAGAATTATCTGATTAAAGGAGG - Intronic
1160553622 18:79712166-79712188 CAGAATGATAGGATCGAATGGGG + Intronic
1164598849 19:29547869-29547891 GGGAATGGTCAGATTGAAGTGGG + Intronic
926118731 2:10229461-10229483 CTGAATGATCTGATTCAAGTGGG + Intergenic
927416459 2:22885820-22885842 CAGCCTGATCGGATTGCAGGAGG + Intergenic
929120348 2:38479047-38479069 CAGATTGATCAGGTTGAAGATGG - Intergenic
929839119 2:45438075-45438097 CAGAATGTTGAGACTGGAGGGGG + Intronic
930775261 2:55164459-55164481 CAGAAAGGACAGTTTGAAGGGGG + Intergenic
930868875 2:56149897-56149919 CAGGAAGAACAGAATGAAGGTGG + Intergenic
936717352 2:115203464-115203486 CAGCATGAACAGATTGGAGAGGG + Intronic
938707225 2:133942856-133942878 AAGATGCATCAGATTGAAGGAGG - Intergenic
941465733 2:165824339-165824361 CAGAATAAGAAGATGGAAGGAGG - Intergenic
941570054 2:167159267-167159289 CAAAATGATTAGCTTGATGGCGG - Intronic
941613761 2:167694971-167694993 CAGAATGGTCAGACTGCAGGAGG - Intergenic
941830539 2:169954088-169954110 CAGAATTAGCAGATTGATAGTGG + Intronic
942279643 2:174347221-174347243 CAGAATGATTAGATTTGAGAAGG + Intergenic
942434427 2:175956316-175956338 GAGAATGATCAGATTTTTGGAGG - Intronic
942645514 2:178106661-178106683 CAGAAAAATCAGATTGAGGCTGG + Intronic
947279573 2:228434985-228435007 CAGAATGAACAGGTTGATGAAGG - Intergenic
947663831 2:231890427-231890449 CAGGATGCTGAGTTTGAAGGGGG + Intergenic
1170474278 20:16699544-16699566 CAGAAGAATCAGATTAAAAGGGG + Intergenic
1171318139 20:24214018-24214040 AAAAATGATCAGATGAAAGGAGG - Intergenic
1171515769 20:25733025-25733047 CATAATAATCTGAGTGAAGGTGG + Intergenic
1172522685 20:35578587-35578609 AAGAATGATCTCATTGAAGGTGG - Intergenic
1172686492 20:36759374-36759396 CAAAATGCTCAGATTACAGGTGG + Intronic
1173372173 20:42446861-42446883 CAGGATTACCAGATGGAAGGAGG - Intronic
1177064900 21:16418536-16418558 CAAAATGATCTGATTGTAGGGGG - Intergenic
1179122977 21:38565887-38565909 CTGAATGATTAGATTGAAATTGG + Intronic
1179374574 21:40838406-40838428 CACAATGATCAGGTAGAAGCTGG - Intronic
1182396890 22:30042683-30042705 GAGAATGCTGAGATTGAAGGAGG - Intergenic
1183160437 22:36109692-36109714 CAGAATGATCAGAAGGGACGTGG - Intergenic
950763387 3:15254993-15255015 CAGAATTAACAGTTTGAAAGAGG + Exonic
951577975 3:24132965-24132987 TAGAAGGATTAGATTGAATGTGG + Intronic
953078915 3:39597282-39597304 CAGAATGATGAGTTTGCAGAGGG - Intergenic
955242930 3:57196130-57196152 CTGAAGGATGAGATTCAAGGGGG + Intergenic
956054511 3:65284339-65284361 CAGGAAGAACAGAGTGAAGGAGG + Intergenic
957496635 3:81000066-81000088 CTGTATGAGCAGATTGAATGAGG - Intergenic
958614175 3:96469431-96469453 CAGAAAAATCAAAATGAAGGTGG - Intergenic
960293498 3:115914955-115914977 AAGAATAATCACATTGAAAGAGG + Intronic
960556609 3:119036920-119036942 GAGGATGATCAGATTTCAGGAGG + Intronic
964696358 3:159511998-159512020 CAGAATTATCAAATTCAACGCGG - Intronic
964843167 3:161016480-161016502 AAGAAGGAACAGGTTGAAGGAGG + Intronic
965846606 3:172969476-172969498 CAGAATCACCTGGTTGAAGGGGG + Intronic
965891130 3:173514707-173514729 TAAAATTATCAGATTCAAGGGGG - Intronic
965906577 3:173714981-173715003 CATAAAGAGCAGATGGAAGGAGG + Intronic
966604441 3:181808461-181808483 AAAGAGGATCAGATTGAAGGGGG - Intergenic
967515378 3:190362414-190362436 CTGACTGGTCAGGTTGAAGGTGG - Intronic
968765544 4:2466775-2466797 AAAAATGATCAGATTTAGGGCGG - Intronic
970717302 4:18941308-18941330 CAATTTGATTAGATTGAAGGAGG + Intergenic
973263738 4:48189684-48189706 CAAAATGATCAGATTCCATGTGG + Intronic
974356642 4:60821074-60821096 AAGAGTAATCAGATTGAAGATGG - Intergenic
976781734 4:88766861-88766883 AAAACTGATAAGATTGAAGGTGG + Intronic
976781833 4:88768525-88768547 TACATTGATAAGATTGAAGGCGG + Intronic
977361370 4:96010603-96010625 GAGAATGATTAGATGGAAGAAGG + Intergenic
980214463 4:129833718-129833740 CAGAATGGAGGGATTGAAGGAGG + Intergenic
980479180 4:133364222-133364244 CAAAATGAATAAATTGAAGGTGG + Intergenic
980485245 4:133449353-133449375 CAGAATGATCAGTGTGAGGTTGG + Intergenic
980493035 4:133554054-133554076 AAGAATGTACAGATTGAAAGTGG - Intergenic
981497392 4:145409619-145409641 CAGAAACATCAGAAAGAAGGAGG - Intergenic
981546559 4:145899863-145899885 CAGAATGTTCAAACTGAAAGAGG - Intronic
981816529 4:148837225-148837247 CAGAAAGAACACACTGAAGGTGG - Intergenic
982725417 4:158901439-158901461 CATAATGGTCAGATTCACGGAGG - Intronic
983143813 4:164187976-164187998 CAGAATACTCAGATTGAACATGG + Intronic
985895441 5:2748200-2748222 CAGAATTAGCAGAGTGAGGGCGG - Intronic
987404166 5:17508027-17508049 CAGAAAGTTCATAGTGAAGGGGG - Intergenic
987411772 5:17621736-17621758 CAGAAAGTTCATAGTGAAGGGGG - Intergenic
987604637 5:20116612-20116634 TGGAATGATAAGATTGAAAGTGG - Intronic
989699146 5:44240587-44240609 CAACATGATTGGATTGAAGGAGG - Intergenic
989955548 5:50355011-50355033 CAGAATGGTCAGGATGCAGGTGG - Intergenic
990196230 5:53319548-53319570 CAGAATCATGAGGCTGAAGGAGG - Intergenic
994944338 5:106366462-106366484 CAAAATGATCAGAGTGAAGAGGG + Intergenic
995250214 5:109984568-109984590 CAGGAGGAACAGAGTGAAGGGGG - Intergenic
997470863 5:134115960-134115982 ATGCATGAGCAGATTGAAGGCGG - Exonic
999319862 5:150607308-150607330 TAGAATGTCCAGAGTGAAGGAGG + Intronic
1000396890 5:160785232-160785254 CAGAAAGTACAGATTCAAGGTGG - Intronic
1000464236 5:161555417-161555439 CAGAATGATGATTTTGAAGAAGG + Intronic
1001794915 5:174493834-174493856 CAGAAAGTTCACAGTGAAGGAGG + Intergenic
1002877999 6:1228008-1228030 CACAATGATGATATTGTAGGTGG - Intergenic
1005995386 6:30927869-30927891 CAGGAAAATAAGATTGAAGGAGG - Intergenic
1006064330 6:31452536-31452558 CAAAATGCTGAGATTGCAGGTGG + Intergenic
1006080216 6:31560729-31560751 AAGAATAATGAGATTGAAGAGGG + Intergenic
1006390948 6:33758126-33758148 CAGACTGATCAGATTACCGGAGG + Intergenic
1006394629 6:33779076-33779098 CAGGATGACCATATTGAAAGTGG - Intronic
1009829017 6:68905639-68905661 TAGAATGATAAAATTGAAGATGG - Intronic
1011638066 6:89393251-89393273 CACAAAGATGAGATTGAAGAGGG + Intronic
1012079074 6:94732937-94732959 TAGAATCATCAGTTAGAAGGAGG + Intergenic
1012279741 6:97314586-97314608 CAGAAAGATCATATGGAAGAAGG - Intergenic
1013544364 6:111141050-111141072 CAGAGTGCTCGGATTTAAGGTGG + Intronic
1013658294 6:112268445-112268467 GAGAAGGATCATATGGAAGGAGG + Intergenic
1013939771 6:115646852-115646874 CATAATCATCAGATTCAACGAGG + Intergenic
1014715434 6:124859606-124859628 GAGAATGGTCAGATTGGAAGGGG + Intergenic
1014953568 6:127588639-127588661 CCTAATGATCAGATAGAATGTGG - Intronic
1014972969 6:127841538-127841560 CAGAAAGATCATTTTAAAGGAGG - Intronic
1017676765 6:156822361-156822383 CACGATCATCAGACTGAAGGAGG - Intronic
1018219065 6:161560570-161560592 CAGAAAGAATAGATTGATGGTGG - Intronic
1019670493 7:2275436-2275458 CAGAATGCTGAGATTACAGGCGG - Intronic
1020373218 7:7457302-7457324 CAGAATGTTGAGAGTGGAGGTGG + Intronic
1020706030 7:11545511-11545533 CAGAAGGATGGCATTGAAGGTGG + Intronic
1026126688 7:67585752-67585774 CTGATTGGTCAGATTGGAGGTGG - Intergenic
1026409900 7:70109421-70109443 CAGAATGAACAGATTGCATTTGG - Intronic
1026658073 7:72274850-72274872 CAAAATGATCAGATTAAAGTTGG - Intronic
1026977944 7:74510035-74510057 CAGCAGGAACAGCTTGAAGGAGG - Intronic
1027547852 7:79552472-79552494 GAGACTGATGAGATTGATGGGGG - Intergenic
1028368854 7:90068140-90068162 CAGAATGAGCAAATTGATGGGGG - Intergenic
1031007292 7:116487926-116487948 CAGAATGTTCACACTGAAGAGGG + Intronic
1032207316 7:129878930-129878952 CAGATCTATCTGATTGAAGGTGG - Intronic
1033267073 7:139895721-139895743 CAGAATCACCAGGTTGAAGTGGG + Intronic
1034166903 7:149032247-149032269 CAGAAAGACCAAATAGAAGGTGG + Intergenic
1034873023 7:154700464-154700486 CAGAATGTTCAGACTCAAGTTGG + Intronic
1035242175 7:157539458-157539480 CAAGATGATCACATGGAAGGCGG - Exonic
1037498776 8:19465594-19465616 CAGAAGGATCAGATTTAAAAGGG - Intronic
1038223775 8:25635753-25635775 CAGGATGATCAGAATTAAAGTGG - Intergenic
1038567124 8:28628995-28629017 CAGAATGAGAAGCTGGAAGGTGG + Intronic
1041961970 8:63628089-63628111 CAGATTGCTGAGATTGCAGGAGG + Intergenic
1042041683 8:64598418-64598440 CAGATTGGTCAGCGTGAAGGAGG - Intronic
1042909406 8:73810015-73810037 CCTAATGATTAGGTTGAAGGAGG - Intronic
1044082531 8:87903459-87903481 GAGAATGATATAATTGAAGGTGG - Intergenic
1044681712 8:94785667-94785689 CAGAAAGAACAGATTGAAGCAGG + Intronic
1044806291 8:96011725-96011747 CAGATGGATCACATTGTAGGGGG - Intergenic
1045746554 8:105429577-105429599 CAGAATGCACAGATTAAATGAGG - Intronic
1047009077 8:120651670-120651692 CATAATGAACATATGGAAGGAGG + Intronic
1047911078 8:129529967-129529989 GAGAATTATCAGAGTGAAGCTGG - Intergenic
1048718123 8:137291194-137291216 CTGAAGGAGCAGATTGAAGTAGG - Intergenic
1051018020 9:12504922-12504944 CAGAATAATCTGATTGAATTGGG + Intergenic
1052538326 9:29776308-29776330 CTGAATGCTAAGATGGAAGGAGG - Intergenic
1052680643 9:31687263-31687285 CAAATTGATTGGATTGAAGGAGG - Intergenic
1052994602 9:34544863-34544885 CTGAATATTCAGATTGAAAGGGG - Intergenic
1055666183 9:78555353-78555375 CAGAAGGCTCAGGATGAAGGAGG + Intergenic
1056635196 9:88325862-88325884 CACAATCTTCAGATTGAAAGAGG + Intergenic
1058838351 9:108879947-108879969 CACAGTAATCAGATTGCAGGCGG + Intronic
1060541093 9:124430803-124430825 CAAAATGATCAGTTTCAAGTGGG - Intergenic
1061442182 9:130613176-130613198 CAGAAGGATCAGAGCAAAGGTGG + Intronic
1062456708 9:136643247-136643269 CAGAATTATCAGATTGAAGGTGG - Intergenic
1188545655 X:31303396-31303418 AAGAAAGATCAGATTTAGGGTGG - Intronic
1190092707 X:47453448-47453470 CAGAATAAACAGATTCAGGGAGG + Intronic
1195133675 X:101880790-101880812 CATAATGTTCTGGTTGAAGGTGG - Intergenic
1195449876 X:104999121-104999143 CAGAATGATCCCATAGGAGGAGG + Intronic
1196052977 X:111324986-111325008 TAGAAGAATCAGATTGGAGGAGG + Intronic
1197712311 X:129680155-129680177 CAGAGTGAACAGATTGGAGGGGG + Intergenic