ID: 1154145205

View in Genome Browser
Species Human (GRCh38)
Location 18:11861247-11861269
Sequence AAGGAGAGCCAGCAGGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1070
Summary {0: 1, 1: 0, 2: 6, 3: 107, 4: 956}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154145205_1154145210 -10 Left 1154145205 18:11861247-11861269 CCTCCCTCCTGCTGGCTCTCCTT 0: 1
1: 0
2: 6
3: 107
4: 956
Right 1154145210 18:11861260-11861282 GGCTCTCCTTCTTCCTTCTAGGG 0: 1
1: 1
2: 0
3: 25
4: 265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154145205 Original CRISPR AAGGAGAGCCAGCAGGAGGG AGG (reversed) Intronic
900242445 1:1623516-1623538 AAGTGGGGCCAGCAGGACGGCGG + Exonic
900397527 1:2459305-2459327 AAGGAGGACCACCAGGAAGGAGG - Intronic
900397532 1:2459321-2459343 AAGGAGGACCACCAGGAAGGAGG - Intronic
900397537 1:2459337-2459359 AAGGAGAACCACCAGGAAGGAGG - Intronic
900397551 1:2459385-2459407 AAGGAGAACCACCAGGAAGGAGG - Intronic
900397570 1:2459449-2459471 AAGGAGAACCACCAGGAAGGAGG - Intronic
900397579 1:2459481-2459503 AAGGAGGACCACCAGGAAGGAGG - Intronic
900397584 1:2459497-2459519 AAGGAGGACCACCAGGAAGGAGG - Intronic
900397589 1:2459513-2459535 AAGGAGGACCACCAGGAAGGAGG - Intronic
900397594 1:2459529-2459551 AAGGAGGACCACCAGGAAGGAGG - Intronic
900397599 1:2459545-2459567 AAGGAGGACCACCAGGAAGGAGG - Intronic
900846171 1:5103212-5103234 CAGGAGAGACAGCATGAAGGGGG - Intergenic
900892318 1:5458402-5458424 AAGGAAAGAAAGAAGGAGGGAGG - Intergenic
901004006 1:6162952-6162974 AGGGAGAGCCGGAAGGAGGGAGG + Intronic
901028138 1:6290070-6290092 CAGGAGTGTCAGCACGAGGGGGG + Intronic
901081962 1:6588682-6588704 GAGGAAACCCAGCAGGAGGTTGG - Intronic
901092842 1:6653707-6653729 CATGTGAGCCAGCAGGAGTGTGG - Intronic
901494639 1:9614012-9614034 AAGGAGCCCCAGCAGGGGAGTGG - Exonic
901637793 1:10678399-10678421 AGGGAGAGGCAGCAGGTGGGTGG + Intronic
901741925 1:11347504-11347526 AGGGAGAGAGAGAAGGAGGGAGG - Intergenic
902209156 1:14892406-14892428 AAAGAGAGACAGCAGGGGGGAGG - Intronic
902469623 1:16639339-16639361 CAGGAGAGACAGCAGGTGGTAGG - Intergenic
903345389 1:22681074-22681096 AGGGAGAGCCAGCCCTAGGGTGG + Intergenic
903349859 1:22711041-22711063 AAGGTGAGCGAGCGGGCGGGCGG + Exonic
903579934 1:24363173-24363195 AAGGACAGCCTGCAGAAGGCTGG + Intronic
903676539 1:25068050-25068072 AGGAAGAACCAGGAGGAGGGTGG - Intergenic
904086967 1:27916183-27916205 AAGGGGAGGGGGCAGGAGGGAGG - Intergenic
904358825 1:29959488-29959510 AAGGAGGACCAGCAGCAGGCAGG + Intergenic
904360565 1:29968714-29968736 AAGCAGAGGCAGCAGGAGGTGGG + Intergenic
904859669 1:33526177-33526199 AAGGAGTGACAGAAGAAGGGAGG + Intronic
905479619 1:38252454-38252476 AAGGAGAGGCAACAGGACTGGGG - Intergenic
905602730 1:39268288-39268310 AGGGAGGGCCAGGAGGAGGAGGG - Intronic
905885707 1:41490765-41490787 AGGGTGAGCCACCAGGAGGCTGG + Intergenic
905942920 1:41878686-41878708 AAAGAGAGGGAGGAGGAGGGAGG - Intronic
906291870 1:44624662-44624684 AAGGACAGGGAGAAGGAGGGAGG + Intronic
906460233 1:46030943-46030965 AAGGAGACCTGGCAGGAGGAGGG + Intronic
906661242 1:47584016-47584038 AAGGACAGTCATCAGGAGGCAGG - Intergenic
906778294 1:48549528-48549550 AGGGAGAGACAGCAGGAGAGAGG + Intronic
907192187 1:52658721-52658743 TAGGAGAGCAGCCAGGAGGGAGG - Intronic
907357856 1:53891127-53891149 AAGGGGAGAGAGAAGGAGGGGGG + Intergenic
907490396 1:54805658-54805680 AAGGAGAGCCAGAGGGTGGAGGG - Intergenic
907667645 1:56447361-56447383 AAGGAGAGGCAGGAGGAAAGGGG + Intergenic
907722465 1:56984550-56984572 AAGGAGTGCCAGCAGCCAGGTGG + Intergenic
907786397 1:57617213-57617235 GAGGAGAGCCACCAGGCTGGGGG + Intronic
907919162 1:58896809-58896831 AGGGAGGGCCAGCAGGAGCCTGG + Intergenic
908170685 1:61501586-61501608 AAGGAGAGACAGCTGGAAGGTGG + Intergenic
908199600 1:61780601-61780623 AGGCAGAGGCAGGAGGAGGGAGG - Intronic
908457521 1:64318783-64318805 AAACAGAGACAGCAGGAAGGAGG + Intergenic
908776958 1:67649701-67649723 AAGGAGAATCAGGAGGAGGTAGG + Intergenic
909232312 1:73106024-73106046 AAGGAGAGCTGGCTGGAGTGTGG + Intergenic
909455084 1:75841172-75841194 AAGAAGAGAAAGCGGGAGGGAGG - Intronic
909562979 1:77025778-77025800 GAGGAGGGGCAGCAGGAGGGAGG - Intronic
909614341 1:77589828-77589850 AAGGAAGGCGTGCAGGAGGGAGG + Intronic
911636160 1:100238289-100238311 ACCTAGAGCCATCAGGAGGGAGG - Intronic
911671029 1:100607809-100607831 AAGGAGAGCCTGCAGGGGACTGG + Intergenic
912385886 1:109270965-109270987 ATGGAGAGCCAGCAGAAGTCAGG - Exonic
912703404 1:111895048-111895070 AGGGAGAGGAAGCATGAGGGAGG + Intronic
912713509 1:111966076-111966098 CTGGGGAGCCAGCAGCAGGGTGG - Intronic
913147817 1:116009451-116009473 AAGGAGAGACAGCAGCAGAATGG + Intronic
914044643 1:144080533-144080555 CAGGACAGCCCGAAGGAGGGGGG - Intergenic
914133467 1:144880153-144880175 CAGGACAGCCCGAAGGAGGGGGG + Intergenic
915047181 1:153028002-153028024 AAGGAGAAGGAGAAGGAGGGAGG - Intergenic
915233904 1:154466253-154466275 AAGGAGAGCTAGCAGCAGGGAGG + Exonic
915299942 1:154946123-154946145 ACAGGGAGCCAGCAGGAAGGTGG - Exonic
915310120 1:155002385-155002407 AAGGAGGGAAAGGAGGAGGGTGG + Intergenic
915345588 1:155195304-155195326 ATGGAGAGCCAGGAGGGCGGGGG - Intergenic
915360544 1:155284100-155284122 ATGGAGACCCAGCAGTCGGGAGG - Exonic
915470591 1:156123605-156123627 AAGTAGTGCCTGGAGGAGGGAGG - Intronic
915488727 1:156239890-156239912 CTGGGGAACCAGCAGGAGGGGGG - Intronic
915520607 1:156440181-156440203 GAGCAGAGACAGCAGGATGGTGG - Intergenic
915562735 1:156696877-156696899 AGGAAAAGCCAGCAGGAGGCTGG - Intergenic
915603815 1:156938586-156938608 AAGGAGAGAGGGCAGGAGGTGGG + Intronic
915662501 1:157415878-157415900 AAGGAGAGTCAGACGGAGGCAGG - Intergenic
915896268 1:159813557-159813579 AAGGACTTCCAGCAGGATGGTGG + Intronic
916037162 1:160932622-160932644 AAGGAGAGTGAGAGGGAGGGGGG - Intergenic
916973367 1:170048680-170048702 ATGGAGAGCAAGCAGAAGCGGGG + Intronic
917117617 1:171618302-171618324 AAGGAGAGTCAGCACTAAGGTGG - Intergenic
917141773 1:171842024-171842046 CAGGAGGGCCACCAGGCGGGGGG - Intronic
917498450 1:175564239-175564261 CAGGGCAGGCAGCAGGAGGGAGG - Intronic
917635893 1:176935858-176935880 AAAGAGAGCAAGAAAGAGGGGGG - Intronic
917854533 1:179090032-179090054 AAGGACAGGCAGCTGGAGGGTGG - Intronic
918057047 1:181031174-181031196 AAGGAGAGAGAGAAGGAGGGAGG - Intergenic
918469983 1:184861800-184861822 AAGAAGAGAGAGAAGGAGGGAGG + Intronic
918761847 1:188420536-188420558 AGGGAGAGACAGAAGGAGGAAGG - Intergenic
919105306 1:193142624-193142646 AAAGAGAGAAAGGAGGAGGGGGG - Intronic
919123993 1:193374810-193374832 AGGGAGAGAGAGAAGGAGGGAGG - Intergenic
919887368 1:201944681-201944703 AAGAAGAGGGAGAAGGAGGGAGG - Intronic
920072043 1:203308976-203308998 AAGGGGCAACAGCAGGAGGGTGG - Exonic
920110500 1:203583857-203583879 AAGGAGAGAGAGAAGGAGGAAGG + Intergenic
920110526 1:203583962-203583984 AAGGAGAGAGAGAAGGAGGAAGG + Intergenic
920381087 1:205534915-205534937 AATGGGAGCCCACAGGAGGGTGG - Intergenic
920410341 1:205754537-205754559 AGAGAGAGCCAGCAGGTTGGAGG - Intergenic
920717528 1:208354701-208354723 GAGGAGAGTGAGAAGGAGGGAGG + Intergenic
921009694 1:211129014-211129036 CTGGAGAACCATCAGGAGGGAGG + Intronic
921049464 1:211500817-211500839 AGGGAGATCCAGGAGTAGGGGGG - Intergenic
921050673 1:211509079-211509101 CAGGAGAGCCAGCAGCCAGGGGG - Intergenic
921261376 1:213388049-213388071 CAGGAGGGCCAGCAGTTGGGGGG - Intergenic
921266294 1:213423500-213423522 AAGGAGAGTACCCAGGAGGGTGG + Intergenic
921838120 1:219799134-219799156 AAGGAGAGAGAGAGGGAGGGAGG + Intronic
922433207 1:225576729-225576751 ATGAAGAGGCAGCAAGAGGGCGG + Intronic
922566827 1:226606570-226606592 CAGCAAAGCCAGCAAGAGGGAGG - Exonic
922707962 1:227800351-227800373 AAGGAGAAGGAGAAGGAGGGGGG - Intergenic
923222380 1:231907091-231907113 AAGGAGAGAAGGAAGGAGGGAGG - Intronic
923540341 1:234884220-234884242 AAGGTGAGGTAGCAGGAGCGTGG + Intergenic
923552972 1:234978914-234978936 AAGCAGAGGCAGCAGGGGGCAGG + Intergenic
923626168 1:235615735-235615757 AAGAAGCACCAGGAGGAGGGGGG + Intronic
924158583 1:241206915-241206937 AAGGAGAGAGAGAGGGAGGGAGG - Intronic
924443946 1:244111101-244111123 AAGGAGAGAAAAGAGGAGGGAGG + Intergenic
1062805310 10:415383-415405 AAGGAGAGGCAGCAGGAGGAGGG + Intronic
1063081923 10:2775469-2775491 AAGGAGAGGAAACAGAAGGGTGG - Intergenic
1063112102 10:3046511-3046533 AAGGTGAGAGAGCAGGTGGGGGG - Intergenic
1063965586 10:11343797-11343819 ACGGAGAGCCTGGAAGAGGGAGG + Intergenic
1064333260 10:14414422-14414444 AAGGAGAGAGAGAGGGAGGGAGG + Intronic
1064379918 10:14832323-14832345 AAGTAGAGGGAGCAAGAGGGAGG + Intronic
1065108925 10:22420930-22420952 CAGGAGAACCAGCAGCAGGTTGG + Intronic
1065296155 10:24277327-24277349 AAGTGGAGCAAGCAGGTGGGTGG + Intronic
1065617931 10:27547753-27547775 ACAGAAAGCGAGCAGGAGGGTGG + Intergenic
1065651482 10:27897091-27897113 AAGGAGAGAAATCAAGAGGGAGG - Intronic
1065736560 10:28758296-28758318 AAGTAGAGACAGAAGGAGGAAGG - Intergenic
1065843838 10:29728704-29728726 AAGGTGAGCTAGCAGCATGGAGG + Intronic
1065845964 10:29743604-29743626 AATGACAGCCAACAGGAGGCTGG - Intergenic
1065895464 10:30159381-30159403 CAGGAGAGCAAGGTGGAGGGTGG - Intergenic
1066235643 10:33481624-33481646 TAGGGGAGCCTGCAGGAGGAGGG + Intergenic
1066278035 10:33887829-33887851 CAGGAGAGCCAGCACGATGTGGG - Intergenic
1067205767 10:44211500-44211522 CAGGAGAAGCAGCATGAGGGGGG - Intergenic
1067696918 10:48542485-48542507 AGGCAGAGGCAGCAGGAGGCAGG - Intronic
1068895498 10:62195479-62195501 AAGGAGAGACAGAAGGAAAGTGG + Exonic
1068933261 10:62612679-62612701 AAGGAGATGCAGAAGCAGGGGGG + Intronic
1069214566 10:65803645-65803667 AAGAAGAGGGAGCAGGAGAGTGG - Intergenic
1069354896 10:67573725-67573747 AAGGAGAGAGGGAAGGAGGGAGG - Intronic
1069900630 10:71704880-71704902 AAGGAGGGGCAGCATGAGGGTGG - Intronic
1070332690 10:75429756-75429778 AAGCAGAGACAGCAGTAGGTGGG + Intergenic
1070428395 10:76311911-76311933 AAGCAGAGCCAACAGGTGGCAGG - Intronic
1070504839 10:77103993-77104015 ATGGAGAGGCAGCAGGACGCAGG + Intronic
1070734334 10:78852928-78852950 AAGGACAGCAGGGAGGAGGGAGG + Intergenic
1070801334 10:79246154-79246176 AAGGTCATCCAGCAAGAGGGTGG + Intronic
1070808414 10:79284784-79284806 AGGGAGGCCCAGCAGGAGAGAGG - Intronic
1071137220 10:82466634-82466656 ATGGAGATCCAGCAGGCAGGTGG + Intronic
1071270924 10:84006608-84006630 AAGGAGAAAGAGCAAGAGGGAGG - Intergenic
1071525235 10:86354505-86354527 ACGTATGGCCAGCAGGAGGGAGG - Intronic
1071554898 10:86594376-86594398 AAGGAGAGGGAGGGGGAGGGAGG + Intergenic
1071718537 10:88120292-88120314 AAGGAGGGGGAGCAGGAAGGAGG + Intergenic
1072248280 10:93562004-93562026 AAAGAGAGAGAGAAGGAGGGAGG + Intergenic
1072267786 10:93746991-93747013 AATGTGAGCCAGCAGTAGGCTGG + Intergenic
1072606881 10:96991803-96991825 AAGCAGAGGCAGGAGGAGGGAGG - Intergenic
1073086732 10:100895874-100895896 AAGGAGAGAGAGAGGGAGGGAGG - Intergenic
1073638301 10:105221900-105221922 AAGAAGAGAAAGAAGGAGGGAGG + Intronic
1073950285 10:108800545-108800567 AAGCAGAGAGACCAGGAGGGAGG - Intergenic
1074086790 10:110214415-110214437 TGGGAAAGGCAGCAGGAGGGGGG - Intronic
1074316685 10:112367822-112367844 ATGGTGAGCCTGCAGGTGGGGGG - Intergenic
1074357771 10:112801156-112801178 CAGGATGGCCAGCAGGAGGTGGG + Intronic
1074828014 10:117228543-117228565 AAGGAGAGAGAGAGGGAGGGAGG - Intergenic
1074828022 10:117228571-117228593 AAGGAGAGAAAGAGGGAGGGAGG - Intergenic
1074909990 10:117899718-117899740 AAGGAGGGACAGAGGGAGGGAGG + Intergenic
1074964087 10:118473448-118473470 AAGGAGAGGGAGCAGAGGGGAGG - Intergenic
1074994979 10:118748948-118748970 AAGAAGAGTCAGGAGGAGGGAGG + Intronic
1075399344 10:122150132-122150154 AAGGAGAGCCGGCAGCAGCGGGG + Intronic
1076024706 10:127101696-127101718 AAGGGGAGCCAGCAGCAGGTGGG + Intronic
1076036362 10:127201739-127201761 AAGGAGAGGCTGCAGTTGGGAGG - Intronic
1076121392 10:127939748-127939770 AAGGAGAGGCAGGAGGAGGCAGG + Intronic
1076230137 10:128813434-128813456 AGGGAGGGACAGAAGGAGGGAGG + Intergenic
1076726619 10:132416909-132416931 AAGGAGGGCCGGCAGGAGCTGGG + Intronic
1076990447 11:270874-270896 AGGGAGAGCCAGCCCGACGGGGG + Intergenic
1077060901 11:617529-617551 AAGGAGCGGCGGCCGGAGGGCGG - Exonic
1077065096 11:637540-637562 CAGGAGAGCGAGGAGGAGGTCGG - Exonic
1077158550 11:1102314-1102336 AGGAAGAGCCAGCAGGAAGCTGG - Intergenic
1077245587 11:1535689-1535711 GTGCAGGGCCAGCAGGAGGGCGG + Intergenic
1077376934 11:2209548-2209570 GAGGAGGGCAGGCAGGAGGGAGG - Intergenic
1077910795 11:6570139-6570161 CAGGAGAGCCTGGAAGAGGGTGG + Intronic
1078398994 11:11007722-11007744 AACAAGAGGAAGCAGGAGGGAGG - Intergenic
1078461988 11:11521144-11521166 AAAGAGAGCCAGGAGGTGGTGGG - Intronic
1078779436 11:14423036-14423058 GAGGAGAGAGAGCTGGAGGGAGG - Intergenic
1078914296 11:15763806-15763828 AAGAAGAGAGAGAAGGAGGGAGG + Intergenic
1079292436 11:19200477-19200499 AAGGAAAGAGAGAAGGAGGGAGG - Intronic
1080219604 11:29886074-29886096 AAAAAGACCAAGCAGGAGGGAGG - Intergenic
1080812871 11:35723016-35723038 AGAGAGAGACAGAAGGAGGGAGG - Intronic
1080896495 11:36452653-36452675 GAGCTGAGCCAGCAGGAAGGTGG - Intronic
1081142383 11:39517474-39517496 AAGGTGTGGCAGCAGGAGAGTGG + Intergenic
1081672096 11:44948192-44948214 CAGGAGAGGCAGCTGCAGGGCGG - Intronic
1082023268 11:47552727-47552749 AAGCAAAGCCACGAGGAGGGCGG + Intronic
1082179769 11:49103314-49103336 AAGCAGAACCAGTAGGAGGGCGG - Intergenic
1083104830 11:60347660-60347682 AAGGAGAGAAAACAGTAGGGTGG - Intronic
1083166024 11:60888425-60888447 AGGGAGAGGGAGCAGGAGAGTGG + Intergenic
1083408072 11:62472302-62472324 AAGGAAGGCCAGCAGTGGGGAGG - Intronic
1083709510 11:64539376-64539398 AACCAGAGGCAGCAGGAGGCTGG + Intergenic
1083742508 11:64718334-64718356 GAGGAGAGCCAGAGGGAGGCCGG - Intronic
1083859389 11:65411867-65411889 ATGGAGCACCAGCAGGAGGAAGG - Exonic
1084184275 11:67463432-67463454 AAGGACAGCCAGCAGGTGGTAGG - Exonic
1084470485 11:69356438-69356460 AAGGAGAGAGGGAAGGAGGGAGG + Intronic
1084696835 11:70760882-70760904 GAGAAGAGCCAGCAGGAGGCGGG + Intronic
1085013786 11:73159374-73159396 AAGTAGAGCCTCCAGGAGGGCGG + Intergenic
1085217253 11:74843692-74843714 AAGGAGAGCCAGCGTGAGGCAGG - Intronic
1085470187 11:76752717-76752739 AAGGAGAGAGGGCAGGAGTGGGG + Intergenic
1085504146 11:77046468-77046490 AAGGAGATCTATCAGGACGGAGG + Intergenic
1085510091 11:77083803-77083825 AACGTCACCCAGCAGGAGGGTGG + Intronic
1086368120 11:86129000-86129022 AATGAGAGAAAGCAGGTGGGGGG + Intergenic
1086520774 11:87665608-87665630 AGAGAGAGAGAGCAGGAGGGAGG + Intergenic
1086555330 11:88103817-88103839 AGTGAGATCCTGCAGGAGGGAGG + Intergenic
1086802097 11:91188755-91188777 AAGGAGAGCCAAAAGGATGTGGG + Intergenic
1088822576 11:113469195-113469217 AAGCAGTGGGAGCAGGAGGGAGG - Intronic
1088828579 11:113516141-113516163 GAGAAGAGAGAGCAGGAGGGAGG - Intergenic
1088996148 11:114999042-114999064 ATGCAGAGCCAGGAGGAGGAAGG + Intergenic
1089050486 11:115540824-115540846 AAGGCGAGCCAACAGAATGGAGG - Intergenic
1089281884 11:117380536-117380558 CTTGAGAGCCAGCAGGAGGATGG + Intronic
1089351631 11:117824708-117824730 AAGCAGAGACAGCAGGAAGAGGG - Exonic
1089606577 11:119644928-119644950 AGGGAGAGGCGGCAGGAGAGAGG - Intronic
1089943220 11:122440949-122440971 AGGAAGAGCCAGGAGGGGGGCGG - Intergenic
1090145132 11:124313223-124313245 AAGGAAAGAAAGAAGGAGGGAGG + Intergenic
1090669145 11:128934008-128934030 AAGGAGAGGGAGGAGGAAGGAGG - Intergenic
1090844925 11:130522483-130522505 ACAGAGGGACAGCAGGAGGGAGG + Intergenic
1091451497 12:575155-575177 GGCGAGAGCCAGCAGGAGCGAGG - Intronic
1091454687 12:598342-598364 AGGGAGGGCAAGGAGGAGGGTGG - Intronic
1091688713 12:2581568-2581590 CCTGAGAGCCAACAGGAGGGAGG - Exonic
1091824012 12:3496143-3496165 AAGGAGAGCCCCCAGGAGTTGGG + Intronic
1092062666 12:5564037-5564059 AGAGAGAGCCAGATGGAGGGAGG - Intronic
1092746500 12:11677271-11677293 AGAGAGAGGCAGGAGGAGGGAGG - Intronic
1092882889 12:12901487-12901509 AAGGGGAGTCAGGAGGAGGACGG - Intronic
1092954884 12:13540798-13540820 AAGGAGAGCCGGCCCCAGGGAGG + Exonic
1093152016 12:15633014-15633036 AAGGAGGGCAAGGAGGAGAGAGG + Intronic
1093561974 12:20552514-20552536 GAGGAGGAGCAGCAGGAGGGGGG + Intronic
1093611469 12:21164401-21164423 GAGGAGAACCAACAGGAGGTGGG - Intronic
1093756167 12:22854278-22854300 AAGGAGAGAAAGAAAGAGGGAGG - Intergenic
1094088228 12:26617741-26617763 AAGGAAGGACAGAAGGAGGGAGG + Intronic
1094174071 12:27524085-27524107 AAAGAGAGTCAGCAGTGGGGCGG - Intronic
1094268838 12:28588937-28588959 AGGGAGAGCCAGGAGGTGGGTGG + Intergenic
1094596769 12:31873251-31873273 ATGGAGAGCCAGACGGTGGGTGG + Intergenic
1094738480 12:33261213-33261235 AAGCAGAGACGTCAGGAGGGAGG - Intergenic
1095948430 12:47767063-47767085 AAGGCGAAGCTGCAGGAGGGGGG + Intronic
1096500083 12:52059321-52059343 AGAGAGAGCCAGCAGGAGGCTGG - Exonic
1096590430 12:52655377-52655399 GAGGCGAGTCAGCAGGAGGCTGG + Intergenic
1096781499 12:53994800-53994822 AGGGAGGGCGAGAAGGAGGGAGG + Intronic
1096783005 12:54001566-54001588 AAGGAGAAACAGCAGGGGAGGGG + Intronic
1096792643 12:54054439-54054461 AAGGAGAGAAAGGAGGACGGGGG - Intronic
1097119656 12:56721376-56721398 CAGGAGAGCAAGGAGGGGGGAGG + Exonic
1097189122 12:57211119-57211141 ATGGAGAGCCCTCATGAGGGTGG + Intronic
1097747311 12:63315460-63315482 AAAGAGAGAGAGAAGGAGGGAGG - Intergenic
1097961183 12:65533395-65533417 CAGCAGAGACAGGAGGAGGGAGG - Intergenic
1097992034 12:65845937-65845959 AAGGGCAGGCAGCAGGGGGGAGG - Intronic
1098264729 12:68706814-68706836 GAGGAGAGCCAGCTGGAGTCTGG + Intronic
1098285540 12:68903789-68903811 AAGGAGAGACAGAGGGAGGGAGG - Intronic
1100206373 12:92354412-92354434 ATGGGGAGCCAGCAGGGGGATGG - Intergenic
1100879919 12:99005108-99005130 AAGGAGAGCCTGTAGAAGAGAGG + Intronic
1101034047 12:100687330-100687352 CAGGACAACCAGCAGGAAGGAGG - Intergenic
1101409447 12:104456891-104456913 GCGGAGAGCCGGGAGGAGGGAGG - Intronic
1101576403 12:106001091-106001113 AAGGAGTGCAAGCAGGAAGAAGG + Intergenic
1101782332 12:107846806-107846828 AGAGAGAGAAAGCAGGAGGGAGG + Intergenic
1101954605 12:109202039-109202061 GAGGACAGCCGCCAGGAGGGAGG - Intronic
1102469178 12:113149933-113149955 AGGGAGGGCTAGAAGGAGGGCGG + Intronic
1102482086 12:113230902-113230924 GAGGAGAGGCGGCAGGAGGGAGG - Intronic
1102746515 12:115253546-115253568 AGAGAGGGCCAGGAGGAGGGTGG + Intergenic
1102875709 12:116447120-116447142 AAGGAGAGCTGGCTGGAGGCAGG + Intergenic
1102907196 12:116685908-116685930 AAGGAGAGAGAGAGGGAGGGAGG + Intergenic
1102994958 12:117342121-117342143 AAGGAGAGAAAGAGGGAGGGAGG - Intronic
1103245768 12:119455888-119455910 AAGGAAAGAAAGAAGGAGGGAGG + Intronic
1103506205 12:121443576-121443598 CAGGAGAGGCAGCAGTGGGGTGG + Intronic
1103848230 12:123914560-123914582 ACCCTGAGCCAGCAGGAGGGAGG + Intronic
1103858976 12:123996621-123996643 AAGGAGAGCAGGCAGGAATGGGG + Intronic
1103915703 12:124374575-124374597 CAGGAGAGCGAGCAGCAGCGAGG - Intronic
1103975635 12:124700948-124700970 AAGGGGAGCGGGCAGGAGGCTGG + Intergenic
1104110394 12:125699033-125699055 TAGGAGACCCAGCAGAAGGAAGG + Intergenic
1104172519 12:126295900-126295922 AAGGAAAGAGAGAAGGAGGGAGG + Intergenic
1105429445 13:20324001-20324023 AAAGAGAGAAAGAAGGAGGGAGG - Intergenic
1105775817 13:23659140-23659162 GAGCAGGGCCAGCAGGACGGTGG - Exonic
1105795562 13:23848864-23848886 AAGAAAAGCCAGAAGGAGAGAGG + Intronic
1105966340 13:25388181-25388203 AAGGAGAGAAAGAAGGAGGAAGG + Intronic
1106170861 13:27286760-27286782 AAGGAGAGTCCGCAGGAGAGAGG + Intergenic
1106239478 13:27899420-27899442 ACTGAGAGACAGCAGGAGGCAGG - Intergenic
1106531262 13:30594366-30594388 AAGGAGGGAGAGCGGGAGGGAGG - Intronic
1107457508 13:40568373-40568395 AAAGAGAGGAAGGAGGAGGGAGG - Intronic
1107570914 13:41657244-41657266 AAGCAGAGCCAAGAGGAGAGAGG + Intronic
1108392107 13:49956592-49956614 AAGGAGAGAGGGAAGGAGGGAGG - Intergenic
1108593950 13:51934677-51934699 CAGGACAGCCAGCAGCAGGATGG - Exonic
1109377922 13:61522833-61522855 ATGGAGAGCCAGAAGGTGGAGGG + Intergenic
1109476909 13:62891404-62891426 AAGGAGAGGCAGAGAGAGGGAGG - Intergenic
1109649765 13:65310396-65310418 AAGGAGAGCCAGCAGGACAATGG - Intergenic
1110438181 13:75498175-75498197 AAGGAGGGAGAGAAGGAGGGAGG - Intergenic
1110456296 13:75693860-75693882 AATGAGAGACAGCAAGATGGGGG - Intronic
1111764006 13:92503225-92503247 AAGGTGAGACAGTAGGAGGGAGG - Intronic
1111983238 13:95038961-95038983 AAGGAGACACAGCAGGAATGAGG + Intronic
1112200424 13:97268974-97268996 GAGGAGGGCCTGCCGGAGGGTGG + Intronic
1112390710 13:98981566-98981588 AAGGTGGGCCAGCTGGAAGGCGG - Intronic
1113222471 13:108120691-108120713 AAACAGAGACAGAAGGAGGGGGG - Intergenic
1113380281 13:109797708-109797730 AAGGACAGCCTGCAGGACTGAGG - Intergenic
1113399288 13:109976383-109976405 GAGGAGAGCCAGCAGCTGGAAGG - Intergenic
1113613692 13:111665824-111665846 AAGGTGAGCCGGCAGGTGGCGGG + Intronic
1113658394 13:112085961-112085983 AAGGCCACCCAGCAGGAGGTGGG - Intergenic
1113754784 13:112803828-112803850 AAGGAGAGGAAGGAGGAGGAGGG - Intronic
1113991189 14:16029460-16029482 AAGGAGAGAGGGAAGGAGGGAGG - Intergenic
1114201220 14:20522572-20522594 AAGGAGAAGGAGGAGGAGGGAGG + Intergenic
1114400279 14:22403704-22403726 AAAGAGAGCCAACAGGATGAAGG - Intergenic
1115356558 14:32454640-32454662 AAGGAGAGAGGGAAGGAGGGAGG - Intronic
1115360004 14:32489926-32489948 AAAGAGAGTCAGCAAAAGGGTGG + Intronic
1115528300 14:34302783-34302805 AAGGAGAGCAGGCATGGGGGAGG + Intronic
1116808810 14:49519884-49519906 CAGGAAGGCCAGAAGGAGGGAGG + Intergenic
1117035699 14:51726415-51726437 AAAGAAAGGCAGGAGGAGGGAGG - Intronic
1117097789 14:52315150-52315172 AATGAGAAGCAGCAGCAGGGTGG - Exonic
1117294639 14:54367681-54367703 AAGGAGAGCCAGAAGATGGTGGG + Intergenic
1117321746 14:54631001-54631023 AGGCAGAGCCAGCAGGCTGGAGG + Intronic
1117790100 14:59331352-59331374 GAGGAGGGCCACCTGGAGGGAGG - Exonic
1118381226 14:65219196-65219218 AAATAGAGCCAGAAGGAGGAAGG - Intergenic
1118676310 14:68188351-68188373 AAGGGGAGAAAGGAGGAGGGGGG - Intronic
1119387405 14:74266227-74266249 CTGGAGGGCCAGCAGGAGGCTGG - Intergenic
1119558651 14:75572430-75572452 CAGGAGAGGCTGCAGCAGGGTGG + Intergenic
1119598125 14:75955448-75955470 AAGGGGAGGAAGCAAGAGGGCGG - Intronic
1119615420 14:76095804-76095826 AAGGACAGACAGTAGGAGGGTGG - Intergenic
1119726111 14:76922701-76922723 AAGGAGAGCGAGCTGGGGGAAGG - Intergenic
1119895096 14:78213389-78213411 AAGGGGAGGGAGCAGGAAGGAGG + Intergenic
1120028449 14:79612443-79612465 AAGGACAGCCAGCCAAAGGGTGG + Intronic
1120396196 14:83970213-83970235 ACCTAGAACCAGCAGGAGGGAGG - Intergenic
1120674775 14:87408322-87408344 AAGGAGAGGAAGGAGGAGAGGGG + Intergenic
1120720039 14:87880823-87880845 AAGGTAACACAGCAGGAGGGAGG + Intronic
1121085102 14:91139892-91139914 AAGGGGAGAAAGCAGGATGGAGG + Intronic
1121442687 14:93958701-93958723 AAGGAGAGACAGCCGGCAGGTGG + Intronic
1121562722 14:94886886-94886908 AGGGAAAGCCAGGAGGTGGGTGG - Intergenic
1121854470 14:97254204-97254226 AAGGAGACACAGAAGGAGGAAGG - Intergenic
1122419069 14:101564089-101564111 GAGGAGGGACAGGAGGAGGGGGG - Intergenic
1122979496 14:105185260-105185282 CAGAAGAGGGAGCAGGAGGGTGG - Intergenic
1123068388 14:105629346-105629368 AAGCGGAGCCAGCACGGGGGAGG - Intergenic
1123072399 14:105648151-105648173 AAGCGGAGCCAGCACGGGGGAGG - Intergenic
1123092408 14:105747670-105747692 AAGCGGAGCCAGCACGGGGGAGG - Intergenic
1123113971 14:105885575-105885597 GAGTAGGGGCAGCAGGAGGGCGG - Intergenic
1123130487 14:105981745-105981767 AAGAAGAGGAAGCAGGAGGGAGG - Intergenic
1202936348 14_KI270725v1_random:91540-91562 CAGGACAGCCCGAAGGAGGGGGG + Intergenic
1123409968 15:20050054-20050076 AAGAAGGGGAAGCAGGAGGGAGG + Intergenic
1123490607 15:20777377-20777399 AAAGAGAGACAGAGGGAGGGAGG - Intergenic
1123519300 15:21056761-21056783 AAGAAGGGGAAGCAGGAGGGAGG + Intergenic
1123547109 15:21346464-21346486 AAAGAGAGACAGAGGGAGGGAGG - Intergenic
1123580724 15:21712966-21712988 AAGAAGGGGAAGCAGGAGGGGGG - Intergenic
1123617373 15:22155589-22155611 AAGAAGGGGAAGCAGGAGGGGGG - Intergenic
1124035649 15:26051602-26051624 AAGGAGGGAAAGCAGGAGGAAGG - Intergenic
1124088849 15:26578898-26578920 AATGAGAGCCAGCAGGAACTTGG - Intronic
1124496236 15:30189096-30189118 AAGCAGAGCCAGCAGGGTCGTGG + Intergenic
1124635955 15:31365432-31365454 GAGAAGACCCAGCAGGAGGCCGG + Intronic
1124747338 15:32349551-32349573 AAGCAGAGCCAGCAGGGTCGTGG - Intergenic
1125818526 15:42607497-42607519 AAAAAGAGGCATCAGGAGGGTGG - Intronic
1125919064 15:43514325-43514347 AAGAGGAGCCAGCAGGGGTGGGG - Intronic
1126176991 15:45745044-45745066 CAGGAGAGACAGCAAGAGAGGGG - Intergenic
1127507431 15:59610506-59610528 AAGGAGGGACGGAAGGAGGGAGG - Intronic
1127656393 15:61060311-61060333 AAGGAGAGCCAAGAGGAACGCGG - Intronic
1128304201 15:66587181-66587203 AAGGAGAAGCAGGAGGAGGAGGG - Intronic
1128818857 15:70634328-70634350 AAGGAGAAGCAGCTGGAGGGGGG + Intergenic
1128979370 15:72175367-72175389 AAGGAGCATCAGCAGGAGAGTGG - Intronic
1129020505 15:72513708-72513730 AAGGAGGGACAGGGGGAGGGAGG - Intronic
1129220871 15:74131007-74131029 AAGTAGACCAAGCAGGAGGCGGG + Intronic
1129231392 15:74199037-74199059 TGGGAGAGCCAGAGGGAGGGTGG + Intronic
1129410921 15:75349851-75349873 GAGGAGAGCCAAGAGGAGGATGG + Intronic
1129454728 15:75670591-75670613 CAGGGCAGCCAGCAGGAGAGGGG - Intergenic
1129461365 15:75701614-75701636 AAGGAGGGCCAGAGGGAGTGTGG - Intronic
1129524747 15:76206614-76206636 AAGGTGAGCCTGGAGGAGGAGGG - Intronic
1129524957 15:76208001-76208023 AAGGAATGTCAGGAGGAGGGTGG + Intronic
1129651934 15:77497156-77497178 AAAGAGAGCCAGCTAGAAGGAGG - Intergenic
1129672483 15:77614945-77614967 CAGGAGATCCAGCTGGTGGGCGG - Exonic
1129699157 15:77757688-77757710 AAAGAGAGCCAGCAGGGGCAGGG + Intronic
1129723469 15:77890193-77890215 AAGGAGGGCCAGAGGGAGTGTGG + Intergenic
1130398246 15:83523740-83523762 AAGAAGAGAGAGAAGGAGGGAGG - Intronic
1130530204 15:84741425-84741447 AAGGACAGCCAACAGGAGCTTGG - Intergenic
1130668574 15:85890526-85890548 AGGGAGAGGCAGCAGGACTGAGG - Intergenic
1131215399 15:90530977-90530999 AAGGGGGGTCAGCAGGAGTGGGG + Intronic
1131331847 15:91507702-91507724 AAGGAGAGACAGCAGGGGACAGG - Intergenic
1131390450 15:92043881-92043903 AGGGAGAAACAGGAGGAGGGAGG - Intronic
1131457870 15:92597339-92597361 AGGGAGGGAGAGCAGGAGGGAGG + Intergenic
1131900621 15:97084012-97084034 AAGGAGAACCCCCAGGAGAGTGG - Intergenic
1132013520 15:98296479-98296501 AAAGAGAGACAGCAGGAGAAAGG - Intergenic
1132185338 15:99798349-99798371 AAGGGGAGGAAGAAGGAGGGAGG + Intergenic
1132219559 15:100095142-100095164 AAGGAGAGGCAGGAGCAGGTTGG - Intronic
1132299517 15:100767400-100767422 AAGGAGAGAAAGATGGAGGGAGG - Intergenic
1132392141 15:101446999-101447021 AAGGTGACACAGCAGGAGGCAGG + Intronic
1132431651 15:101766182-101766204 AAGGAGAGGAAGAAGGAGGGAGG - Intergenic
1202955439 15_KI270727v1_random:73680-73702 AAAGAGAGACAGAGGGAGGGAGG - Intergenic
1202989594 15_KI270727v1_random:447211-447233 AAGAAGGGGAAGCAGGAGGGGGG - Intergenic
1132632307 16:924661-924683 AATGAAAGCCAACTGGAGGGCGG - Intronic
1132727753 16:1346096-1346118 GAGGGGAGCCGGCAGGAGGTGGG + Intronic
1132763830 16:1524613-1524635 TACGAGAGCCAGGAGGAGGTCGG - Exonic
1133026157 16:2989791-2989813 AAGGAGAGAGGGAAGGAGGGAGG + Intergenic
1133327251 16:4949262-4949284 AGGAGGAGCCAGGAGGAGGGAGG - Intronic
1133337715 16:5016825-5016847 ACAGAGAGCCAACAGGAAGGTGG - Exonic
1133597103 16:7303851-7303873 AAGGATAGCGAGAGGGAGGGAGG - Intronic
1133619715 16:7514588-7514610 AAGGAAAGCCTGCTGGAGGAGGG + Intronic
1134060246 16:11195127-11195149 AAGGAGAGGAGGCAGAAGGGAGG - Intergenic
1134081354 16:11327214-11327236 ATGGAGAGGCAAGAGGAGGGAGG + Intronic
1134782105 16:16907457-16907479 AAAGAGAGACAGAAGGAGAGAGG - Intergenic
1135637934 16:24094938-24094960 AAGGAGGGACAGAAGGAGGGAGG + Intronic
1135674569 16:24404469-24404491 TAGAAGAGTCAGCAGGACGGAGG + Intergenic
1135806462 16:25547268-25547290 AAGAAGGGCCAGATGGAGGGAGG - Intergenic
1136054565 16:27678787-27678809 AAGGTGAACCTGAAGGAGGGAGG + Intronic
1136405083 16:30040601-30040623 TAGGAGAGGCAGAAGGAGTGAGG + Intronic
1136472960 16:30494143-30494165 AAGAACACCCAGCAGGAGAGGGG - Intronic
1138014658 16:53417553-53417575 AAGGAGAGAGAGGAGGAGAGAGG - Intergenic
1138333285 16:56232162-56232184 TAGGAGAGGCTGCAGGAGGGAGG - Intronic
1138425380 16:56928701-56928723 AAAGAGTGCCAGCAGGCCGGGGG + Intergenic
1138530830 16:57633516-57633538 TAGGAGAGGCAGCACGAGGTGGG + Intronic
1138647539 16:58435965-58435987 TAGGAGAGCCACCAGGGGGCTGG + Intergenic
1139095014 16:63694903-63694925 AAGGAGAGCCATCAAGAGGTTGG + Intergenic
1139228030 16:65252155-65252177 AATGAGAGCCTGCAGGAATGTGG - Intergenic
1139341742 16:66271912-66271934 AACCAGAGCCAGAAGGAGAGGGG + Intergenic
1139433716 16:66924802-66924824 AAGCAGAGGCAGCAGGTGAGGGG - Exonic
1139837267 16:69849209-69849231 AAGCAGAGCTAGCAGGGAGGAGG + Intronic
1139957893 16:70701791-70701813 GAGGAGGGACAGCAAGAGGGAGG - Intronic
1140092326 16:71848916-71848938 AAAAAGAGCCAGCAGGAGGCTGG + Intronic
1140832803 16:78767073-78767095 AAGGAGAGAGAGAAGGAGGGAGG - Intronic
1140906687 16:79415316-79415338 AAGGAGAGAAGGAAGGAGGGAGG + Intergenic
1140914615 16:79482953-79482975 AAGGAGGGACAGAGGGAGGGAGG - Intergenic
1140914711 16:79483189-79483211 AAGGAGGGACAGAAGGAGGGAGG - Intergenic
1141141657 16:81500382-81500404 AAGGAGAGAGAGAAGGAGGAAGG - Intronic
1141270990 16:82541123-82541145 AGGGAGAGTCAGGAGGAGGGAGG + Intergenic
1141423442 16:83931421-83931443 AAGGAGGGCCTGGAGCAGGGAGG + Intronic
1141516637 16:84549229-84549251 GAGGAGAGGCAGGAGGATGGAGG + Intronic
1141672944 16:85502388-85502410 AAGGACAGCTCCCAGGAGGGAGG + Intergenic
1141766665 16:86063690-86063712 AAGGAGAGGGAGGAAGAGGGAGG + Intergenic
1141868943 16:86771333-86771355 GAGGAGAGCCACCAAGCGGGAGG - Intergenic
1141992447 16:87618299-87618321 AAGAGGAGGCAGGAGGAGGGAGG + Intronic
1142002237 16:87670528-87670550 AAGGATAACCAACAGGAGGCTGG - Intronic
1142203750 16:88773148-88773170 AATGAGACCCAGGAGGAAGGAGG - Intronic
1142395473 16:89828973-89828995 AAGGAGGGAGAGAAGGAGGGAGG - Intronic
1143071202 17:4294993-4295015 AAGGAGAGACGGAGGGAGGGAGG + Intronic
1143289866 17:5820495-5820517 AAGAAGAGCAGGCAGGCGGGAGG - Intronic
1143361128 17:6372189-6372211 GAGAAGAAGCAGCAGGAGGGAGG + Intergenic
1143682983 17:8491441-8491463 TAGGAGACCCAGCAGAAAGGTGG + Intronic
1143725618 17:8843274-8843296 AGGGAGAGAGAGAAGGAGGGAGG - Intronic
1143812040 17:9479802-9479824 CAGGAGAGCTGGCAGGAGGCGGG - Intronic
1144048110 17:11471353-11471375 AGGGAGGACCAGCAGGAGGCTGG - Intronic
1144721191 17:17470921-17470943 AGAGAGAGCCAGCAGGAAGGAGG + Intergenic
1144826394 17:18107923-18107945 AAGGAGAGCCAGGAGAACTGGGG - Exonic
1144886315 17:18465017-18465039 AGGGAGACCAAGCAGGAGAGAGG - Intergenic
1144889110 17:18483817-18483839 AAGGGGAGCAAACAGGAGGCCGG + Intronic
1145009434 17:19359314-19359336 AGAGCGAGCCAGCAGGAGAGTGG - Intronic
1145059965 17:19726688-19726710 GAGGAGAACGAGGAGGAGGGGGG + Intergenic
1145124018 17:20285766-20285788 AAGGGGAGAGAGAAGGAGGGAGG - Intronic
1145143099 17:20460479-20460501 AAGGGGAGCAAACAGGAGGCCGG - Intronic
1145145891 17:20479294-20479316 AGGGAGACCAAGCAGGAGAGAGG + Intergenic
1145751942 17:27361509-27361531 AAGGAGAGGCAGCAGGATGGAGG - Intergenic
1145763179 17:27439444-27439466 AGGGAGACCAAGCAGGAGAGAGG - Intergenic
1145965122 17:28911521-28911543 AAGTAGAGGCAGCAGGGAGGTGG - Intronic
1146265576 17:31450605-31450627 AAAGGGACCCAGGAGGAGGGCGG - Intronic
1147016327 17:37494618-37494640 AAAGAGAAGGAGCAGGAGGGAGG + Intronic
1147350036 17:39835200-39835222 AAGGAGAGCCAGCTGAAGTCTGG - Intronic
1147770351 17:42863765-42863787 AAGGAGAGAGAGAGGGAGGGAGG - Intergenic
1147927379 17:43954004-43954026 AGGGGGAGCCAGCAGGGGGTGGG + Intronic
1148218336 17:45846033-45846055 CAGCAGGGCCAGCAGGAAGGAGG - Exonic
1148245046 17:46024950-46024972 AAGGCAAGCTGGCAGGAGGGTGG + Exonic
1148427167 17:47608743-47608765 AAGGAGAGCCAGGAGAGAGGGGG + Intronic
1148681995 17:49479482-49479504 CAGGAGAGCCAGGGGAAGGGCGG + Intergenic
1149170559 17:53805342-53805364 GAGGAGAGTCAGGAGTAGGGAGG + Intergenic
1149395863 17:56243236-56243258 AAGGAGAGTGAGATGGAGGGAGG - Intronic
1149934198 17:60787639-60787661 AAGGAGATAGAGTAGGAGGGAGG + Intronic
1150096616 17:62381682-62381704 GAGGGCAGCCAGCAGGAGGGAGG - Intronic
1150139581 17:62716889-62716911 AAGGACAAGCAGCAGGAGGGTGG + Intronic
1150477868 17:65488166-65488188 AAGGAGAGAGAGAGGGAGGGAGG + Intergenic
1150477915 17:65488386-65488408 AAGGAGAGAGAGAGGGAGGGAGG + Intergenic
1150634859 17:66905750-66905772 CAGGATAGCAAGCAGGAGAGTGG + Intergenic
1151232380 17:72694183-72694205 CAGCAGAGCCAGCATGAGAGAGG - Intronic
1151319448 17:73343687-73343709 AGGGAGGGCCAGAAGGAGGCAGG + Intronic
1151584758 17:75002278-75002300 AAGGAGAGGCAGCAGGCAGCAGG + Intronic
1151677983 17:75609647-75609669 AAAGAGAGAGAGGAGGAGGGAGG - Intergenic
1151948048 17:77330108-77330130 AAGGAGAGGAGGCAGGAGGCAGG - Intronic
1152043077 17:77917558-77917580 AAGGAGAGGAAGGAGAAGGGGGG + Intergenic
1152228009 17:79101659-79101681 AAGGAGAGAGAGGAAGAGGGAGG + Intronic
1152336712 17:79703097-79703119 GAGGAGAGGGAGGAGGAGGGGGG - Intergenic
1152445675 17:80341456-80341478 AAGGAGAGGCTTCAGCAGGGAGG - Intronic
1152495033 17:80665136-80665158 AACCAGAGACAGCAGGTGGGAGG - Intronic
1152641260 17:81450255-81450277 AAGGACATCCAGCAGGAGACAGG - Intronic
1153151448 18:2099423-2099445 AGGGAGGGACAGAAGGAGGGAGG + Intergenic
1154145205 18:11861247-11861269 AAGGAGAGCCAGCAGGAGGGAGG - Intronic
1154306464 18:13234230-13234252 GAGGAGCCTCAGCAGGAGGGAGG - Intronic
1155071479 18:22320715-22320737 AGGGAGAGAGAGGAGGAGGGTGG + Intergenic
1155180177 18:23338421-23338443 AATGAGAGCCAGCAGTTGGCAGG - Intronic
1155219228 18:23669403-23669425 AAGGAGAGAGAGAGGGAGGGAGG - Intergenic
1156508279 18:37613051-37613073 AAGGAGACCCAGGAGCAGGCTGG - Intergenic
1156636680 18:39039315-39039337 AAGGAAGGACAGAAGGAGGGAGG + Intergenic
1156966493 18:43100363-43100385 AAGTAGAGAGAGCAAGAGGGAGG + Intronic
1156983395 18:43320808-43320830 AGGGAGGGACATCAGGAGGGAGG - Intergenic
1156983400 18:43320824-43320846 AGGGAGGGACATCAGGAGGGAGG - Intergenic
1157063530 18:44321023-44321045 GAGGAGAGCCAGCTGGAGTCTGG - Intergenic
1157283403 18:46360721-46360743 AAGGGGGGCCTGCAGGAAGGAGG - Intronic
1157327553 18:46679986-46680008 CAGGAGGGACAGCAGGAGAGGGG + Exonic
1157499015 18:48177181-48177203 AAGCAGGGCCAGCTGGAGGGTGG + Intronic
1157854941 18:51097003-51097025 AGGGAAAGGCAGGAGGAGGGAGG - Intergenic
1158243644 18:55406095-55406117 CAGCACAGCCAGCAGGAGGCTGG + Intronic
1158571930 18:58603555-58603577 GCTGAGAGCCAGCAGGAGGGAGG - Intronic
1158770619 18:60512782-60512804 AAGTAGACCCAGGAGGAGGCTGG - Intergenic
1159122084 18:64182879-64182901 AGGGAGAGGCAGAGGGAGGGAGG - Intergenic
1159881450 18:73862065-73862087 AAGTAGAGCGAGTATGAGGGAGG + Intergenic
1160016107 18:75141853-75141875 CAGGAGAGCCTGCAGCAGGAAGG - Intergenic
1160341028 18:78088846-78088868 AATGAGAGCCTCCAGGAGGCAGG + Intergenic
1161103048 19:2430745-2430767 GAGGAGACCCGCCAGGAGGGAGG + Exonic
1161122908 19:2539968-2539990 AAAGAGAGAGAGAAGGAGGGAGG - Intronic
1161404352 19:4083302-4083324 CAGGGGAGACAGCAGGATGGTGG + Intergenic
1161513769 19:4685370-4685392 AGGGAGAGTCAGCAGGCGGAGGG + Intronic
1161557802 19:4954416-4954438 GAGGAGGAGCAGCAGGAGGGGGG + Exonic
1161789275 19:6349358-6349380 AGGGAGGGACAGAAGGAGGGAGG + Intergenic
1162844474 19:13381805-13381827 AAGCAGAGCGAGCAAGGGGGAGG + Intronic
1162959452 19:14117501-14117523 AAGGGCAGCGAGCAGGAGAGCGG - Exonic
1163053822 19:14704071-14704093 GTGAAGAGGCAGCAGGAGGGTGG - Intronic
1163054188 19:14706080-14706102 CAGGAGAGGCAGCTGGAGGTGGG - Intronic
1163120439 19:15214057-15214079 AGTGAGAACCAGCAGGAGTGAGG + Intergenic
1163152206 19:15422313-15422335 AGGGAGAGGGAGCAGGAGTGGGG + Exonic
1163204888 19:15795170-15795192 AAGGAAGGCAAGGAGGAGGGGGG - Intergenic
1163624683 19:18382401-18382423 AAGGAGAGCCAGGAGGAGCTGGG + Intronic
1163690896 19:18737723-18737745 GAGGAGCAGCAGCAGGAGGGCGG - Intronic
1164426033 19:28142641-28142663 AGGGAGAGAAGGCAGGAGGGAGG + Intergenic
1164581656 19:29438780-29438802 AGGGAGAGACAGAGGGAGGGAGG + Intergenic
1164750871 19:30653889-30653911 GACAAGAGCCAGCAGCAGGGGGG - Intronic
1164853913 19:31505805-31505827 CAGGAGAGCAAGCAGGAGTGGGG + Intergenic
1164896606 19:31882473-31882495 AAGGTGAGCCAGCAGCAAAGAGG - Intergenic
1164934677 19:32201565-32201587 AAGGAGAATCAGCAGGGTGGAGG + Intergenic
1165255827 19:34576843-34576865 GAGTAGAGGCAGCAGCAGGGCGG + Intergenic
1165434076 19:35787305-35787327 CAACAGAGCCAGCAGGAGTGTGG + Exonic
1165789775 19:38484379-38484401 AAGGAGAGAGGGAAGGAGGGAGG - Intronic
1165925993 19:39326686-39326708 AAGGAGGACGAGGAGGAGGGGGG + Intergenic
1166043979 19:40218601-40218623 GAGGAGAGCAGGCAGGAGGTTGG - Intergenic
1166302569 19:41920898-41920920 AGGGAGAGACAGAGGGAGGGGGG - Intronic
1166433081 19:42742525-42742547 AAGAAGAGGGAGCAGCAGGGTGG + Intronic
1166541831 19:43610843-43610865 CTGGGGACCCAGCAGGAGGGTGG - Intronic
1166546480 19:43637097-43637119 GAGGAGAGAAAGCAAGAGGGAGG - Intronic
1166599589 19:44082223-44082245 CAGGACAACCAGCAGGAAGGAGG - Intronic
1166686033 19:44796884-44796906 CAAGAGAGCCAGCAGGAAGCGGG + Intronic
1166912692 19:46171320-46171342 AAGGGGAGTCAGCCAGAGGGAGG + Intergenic
1167619225 19:50551870-50551892 AAGGAGAGAAAGAAGGAGGGAGG - Intronic
1167854311 19:52225825-52225847 ACGGAGCCCTAGCAGGAGGGTGG + Intronic
1167970016 19:53183518-53183540 AAGTACAGCCAGAAGGTGGGGGG - Intronic
1168102400 19:54148231-54148253 AGGCAGAGGCAGCAGGCGGGGGG - Exonic
1168247322 19:55118930-55118952 AAGGAGTTCCAGCAGGTGGGGGG + Intergenic
1168307498 19:55443314-55443336 CAGGGGAGGCAGCTGGAGGGAGG + Intergenic
1168498446 19:56873683-56873705 AAGGTGAGCCAGCAGCTGGCAGG - Intergenic
1202684201 1_KI270712v1_random:33952-33974 CAGGACAGCCCGAAGGAGGGGGG - Intergenic
925134267 2:1515400-1515422 AAGGAGATCCTGGAGGCGGGAGG + Intronic
925170980 2:1750482-1750504 AAGGAGGGAAAGAAGGAGGGAGG - Intergenic
925251313 2:2441260-2441282 AAGGAGACCCAGAATGTGGGTGG - Intergenic
925260556 2:2524889-2524911 AATGAGACCCAGCAGGAGCAGGG - Intergenic
925553684 2:5104990-5105012 CAGGAGCACCAGCTGGAGGGAGG + Intergenic
925606793 2:5667853-5667875 AAGGAGGGAGAGAAGGAGGGAGG + Intergenic
925933851 2:8734149-8734171 AAGGGGAGGCAGCAGGAGTGGGG + Intronic
926123665 2:10258251-10258273 AAGGTGAGCAAGGAGGAGGAAGG - Intergenic
926214792 2:10898342-10898364 ATGGAGAGAGAGCAGGAAGGTGG - Intergenic
926712228 2:15890799-15890821 AAGGAGCGGGAGCAGGATGGCGG - Intergenic
927374804 2:22401390-22401412 AGGGAGAGATAGCAGGATGGAGG - Intergenic
927773078 2:25880491-25880513 AAGGAAATCCAGAAGGAGGGTGG - Intergenic
927936279 2:27078569-27078591 GAGGGGAGCCAGCAGGGAGGAGG + Exonic
928287392 2:30004760-30004782 CAGAAGAGCCAGCACGAAGGAGG - Intergenic
928363110 2:30681277-30681299 AAAGAGAGGGAGCAGGAGAGAGG + Intergenic
928443401 2:31312128-31312150 AAAGAGGGCCAGAAGGAGAGAGG + Intergenic
928921812 2:36534580-36534602 AGGGAGAGACAGGAAGAGGGAGG + Intronic
928921873 2:36535098-36535120 AAGGAGAGAGGGAAGGAGGGAGG + Intronic
929242530 2:39666549-39666571 AAGGAGAGGGAGAAGAAGGGAGG - Intronic
929712983 2:44283114-44283136 AAGGAGGGACTGGAGGAGGGAGG - Intronic
929781688 2:44961313-44961335 AAGGCAAGGCAGCAGGAAGGAGG - Intergenic
930233902 2:48870901-48870923 AAAGAGAGCAAGCTGGAGAGAGG + Intergenic
931464558 2:62475124-62475146 CAGGAGAAGCAGCAGGAAGGGGG + Intergenic
931819277 2:65935241-65935263 AAGGAGAGCCAGAAGGACAAAGG + Intergenic
932415451 2:71570739-71570761 AGGGTGAGCCAGCAGGTGGTGGG + Exonic
932500567 2:72179514-72179536 AAGGAGAACCTGCAGGAAGCAGG + Intronic
932564820 2:72899617-72899639 AAGGAGAGAAGGAAGGAGGGAGG + Intergenic
933003988 2:76966346-76966368 AAAGAGAGACAGCAAGAAGGGGG + Intronic
933141438 2:78795743-78795765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
933148963 2:78891346-78891368 AAGGAGAGACAGAAGGAAGGAGG - Intergenic
933339568 2:81004871-81004893 AAGGAGAGCCAGCAATTGTGAGG - Intergenic
933585771 2:84178079-84178101 AAGGCGAGACGGCAGGGGGGCGG - Intergenic
933628861 2:84633713-84633735 AAGGGAAGCCAGCAGGAAGAAGG - Intronic
934247518 2:90320900-90320922 CAGGACAGCCCGAAGGAGGGGGG + Intergenic
934261806 2:91481701-91481723 CAGGACAGCCCGAAGGAGGGGGG - Intergenic
934304846 2:91812680-91812702 TAGGACAGCCCGAAGGAGGGGGG - Intergenic
934328411 2:92040070-92040092 TAGGACAGCCCGAAGGAGGGGGG + Intergenic
935489497 2:103698857-103698879 ATAGAGAACCAGCAGCAGGGTGG - Intergenic
936284490 2:111171684-111171706 AAGGAGAACATGCTGGAGGGTGG - Intergenic
936291306 2:111225975-111225997 AAGGGGAACCAGTGGGAGGGAGG + Intergenic
936477001 2:112848126-112848148 AAGGAAAGGAAGGAGGAGGGAGG - Intergenic
936528003 2:113255197-113255219 AAGGAGAGAGGGAAGGAGGGAGG + Intronic
937289567 2:120773958-120773980 AAGGAGAGAGGGAAGGAGGGAGG - Intronic
937737251 2:125307100-125307122 AAGGAGGGAAAGAAGGAGGGAGG + Intergenic
937793793 2:125993248-125993270 AAGGGGAGCGGGCGGGAGGGGGG - Intergenic
938062035 2:128261889-128261911 GAGCAGGGCCGGCAGGAGGGAGG + Intronic
938105353 2:128526312-128526334 CAGGAGAACCAGAGGGAGGGTGG - Intergenic
938381294 2:130837699-130837721 CAGGTGAGCCAGCGGGAGGGCGG + Intronic
938397945 2:130964316-130964338 AAGGAAAGGCAGGAGGGGGGCGG - Intronic
938935901 2:136127425-136127447 AAAGTGGGACAGCAGGAGGGTGG - Intergenic
939967414 2:148624049-148624071 AGGGAGAGACAGGAGGAGAGAGG - Intergenic
940283494 2:152010863-152010885 AAGGACAGCAACCAGCAGGGAGG + Intronic
940342873 2:152599881-152599903 CATGAGAGCCAGCAGCAGGTTGG + Intronic
940702035 2:157057308-157057330 AAGGTGAGCGAGCAGAAGGATGG - Intergenic
941282283 2:163567922-163567944 AAGGAGAGAGAGAAGGAGGGAGG + Intergenic
941571569 2:167176300-167176322 ACGGAGGGCGAGCAGAAGGGTGG - Intronic
942245442 2:174003791-174003813 AAGCAGAGCCAGCCTGACGGTGG - Intergenic
942248979 2:174031982-174032004 TGGGTGAGTCAGCAGGAGGGAGG - Intergenic
942348582 2:175029210-175029232 AAATAGAGGCAGCAAGAGGGGGG + Intergenic
942971940 2:181967656-181967678 AAAGAGAGAGAGAAGGAGGGAGG - Intronic
943499254 2:188666190-188666212 AAGGAGAGAGAGAGGGAGGGAGG - Intergenic
943585498 2:189734607-189734629 AAGGAGGGTCAGGAGGTGGGTGG + Intronic
944398677 2:199300160-199300182 AAGGAGAGAGGGAAGGAGGGAGG + Intronic
944772209 2:202925832-202925854 AAGGAGAGCCAGGTGGAGTCTGG + Intronic
945431983 2:209775281-209775303 AGGGAGAGCAGGAAGGAGGGAGG - Intronic
945831778 2:214795912-214795934 AGGGATATCCAGCAGGAGGATGG - Intronic
946054511 2:216889114-216889136 AGGGAGAGACAGCAGGGGAGGGG + Intergenic
946210469 2:218143535-218143557 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
946219153 2:218211537-218211559 AAGGAGCCCCAGCAGGAGGAAGG - Intergenic
947411266 2:229843081-229843103 AGGGAGAGAGAGAAGGAGGGAGG - Intronic
947572796 2:231249163-231249185 AAGTAGAGACAGCAGCAGGATGG - Intronic
948213706 2:236213714-236213736 AGGGTGAGCCAGCAGAATGGGGG + Intronic
948268865 2:236658394-236658416 AAGGAGGGAGAGAAGGAGGGAGG - Intergenic
948361444 2:237423261-237423283 AGGGAGGGAGAGCAGGAGGGAGG + Intronic
948673799 2:239585172-239585194 AGGAAGGGCCAGCAGCAGGGAGG - Exonic
948724206 2:239921877-239921899 AAGGAGAGAGGGAAGGAGGGAGG - Intronic
948939246 2:241187897-241187919 AAGGAGAGGGAGGAGTAGGGGGG + Intergenic
1168769641 20:407425-407447 AAGGAGGCCCAGGAGGAGGCTGG + Intergenic
1168998239 20:2148127-2148149 TAGGAGAGCCCACAGGAGGAAGG + Exonic
1169210868 20:3765707-3765729 AGGGGGAGGCAGGAGGAGGGAGG - Intronic
1169278994 20:4251230-4251252 GTGGAGAGCCAGCAGAAGGCTGG + Intergenic
1169440128 20:5626927-5626949 AAGGGGAGCCAGAAGGGGGATGG - Intergenic
1170573016 20:17642950-17642972 GAGCATGGCCAGCAGGAGGGTGG + Intronic
1170651320 20:18245270-18245292 CAGGAGAGCCAGCAGGAGCAGGG + Intergenic
1171166477 20:22976426-22976448 GAGGAGAGTGAGCAGGTGGGTGG + Intergenic
1171467008 20:25336833-25336855 ATGGAGAGGCAGGAGGAGTGGGG + Intronic
1171785844 20:29464056-29464078 AAGGAGAGAGGGAAGGAGGGAGG - Intergenic
1171813398 20:29763025-29763047 AAGGAGAGAGGGAAGGAGGGAGG + Intergenic
1171959787 20:31485483-31485505 AGGGAGACCCAGGAGGAGGCTGG - Intergenic
1172074300 20:32282251-32282273 AGGTAGAACCAGCAGGATGGCGG + Intronic
1172204459 20:33153043-33153065 AAGGGGAGAAAGCAGGAGTGGGG - Intergenic
1172260708 20:33562347-33562369 AGAGAGAGGAAGCAGGAGGGAGG + Exonic
1172335708 20:34113642-34113664 AAAGAAAGAAAGCAGGAGGGAGG + Intergenic
1172843603 20:37916359-37916381 AAGGAGTGAGAGCAGGTGGGAGG - Intronic
1173754311 20:45501580-45501602 AAGGAGAGAAAGAAGGATGGTGG - Intergenic
1174221545 20:48959530-48959552 AAGGAGGGACAGAGGGAGGGAGG - Intronic
1175055170 20:56191305-56191327 AGGCAGAGCCAGCAGGAGGACGG + Intergenic
1175605906 20:60312011-60312033 AAGGGGAGGCAGCAGGAGGCAGG + Intergenic
1175774159 20:61642344-61642366 ATGGGGAACCAGCAGGTGGGTGG + Intronic
1176050330 20:63115946-63115968 AATCAGAGACAGCAGGAGCGGGG - Intergenic
1176100647 20:63362958-63362980 AGGGAGAGCCGTCAGCAGGGTGG - Intronic
1176361147 21:5997689-5997711 ATGAAGAGGCAGCAAGAGGGTGG + Intergenic
1176587149 21:8598059-8598081 CAGGACAGCCCGAAGGAGGGGGG - Intergenic
1178100347 21:29261476-29261498 AAGGAGAGAGAGAGGGAGGGAGG + Intronic
1178290908 21:31367123-31367145 AAGGAGAGAAGGAAGGAGGGAGG + Intronic
1178792610 21:35714060-35714082 GAGGAGAGCAAGCACCAGGGAGG + Intronic
1178824667 21:36005031-36005053 AGGGAGAGGCAGGGGGAGGGGGG + Intergenic
1179346627 21:40564473-40564495 AAGTAGAGGAAGGAGGAGGGTGG - Intronic
1179462326 21:41545599-41545621 AAGGAGAGAGAGAGGGAGGGAGG + Intergenic
1179471120 21:41611199-41611221 AAGGAGAGATAACAGGATGGGGG + Intergenic
1179762371 21:43540861-43540883 ATGAAGAGGCAGCAAGAGGGTGG - Intronic
1179822702 21:43945941-43945963 AGGAGAAGCCAGCAGGAGGGTGG + Intronic
1180131755 21:45831115-45831137 GAGCAGAGCCAGCTGCAGGGAGG - Intronic
1180269980 22:10575056-10575078 CAGGACAGCCCGAAGGAGGGGGG - Intergenic
1180316079 22:11278064-11278086 AAGGAGAGAGGGAAGGAGGGAGG + Intergenic
1180587927 22:16909807-16909829 CAGGACAGCCCGAAGGAGGGGGG + Intergenic
1180898264 22:19353114-19353136 CAGGACAGGCAGCAGGACGGAGG - Intronic
1180953135 22:19729776-19729798 ACGGAGAGCCGGCAAGAGGAGGG - Intergenic
1181276104 22:21688373-21688395 TTGGAGAGGCTGCAGGAGGGAGG - Intronic
1181422333 22:22810645-22810667 AAGGAGAGGCAGAGGGAGGAGGG - Intronic
1181886034 22:26023126-26023148 AAGGAGACCCAGAAGGGCGGTGG - Intronic
1182007042 22:26969715-26969737 AAGGAGAGAGAGAGGGAGGGAGG - Intergenic
1182426870 22:30278247-30278269 CTGGAGAGCCAGCAGGGTGGGGG + Intergenic
1182681019 22:32080182-32080204 AGGCAGAGCCAGGAGGTGGGAGG - Intronic
1182738296 22:32546868-32546890 AAGGAGAGAGAGAAGGAGAGAGG - Intronic
1183341917 22:37286298-37286320 AAGGTGACACAGCTGGAGGGTGG - Intronic
1183368158 22:37417974-37417996 GAGGGGGGACAGCAGGAGGGAGG + Intronic
1183457321 22:37929944-37929966 AAGGACACACAGCAGGTGGGAGG - Intronic
1184038823 22:41931661-41931683 AAGATGAGCCAGCAGATGGGAGG + Intergenic
1184406705 22:44304628-44304650 CAGGAGGGCCAGAAGGAGGCTGG - Intronic
1184451492 22:44585453-44585475 AAGGAGAGAAGGCAGGAAGGAGG + Intergenic
1184918104 22:47587104-47587126 CAGGACAGCCAGCAGGAGAGAGG - Intergenic
1185202289 22:49514946-49514968 AAGGAGTACCAGCAGCAGGCGGG + Intronic
949432427 3:3991880-3991902 AAGGAGGGAGAGAAGGAGGGAGG + Intronic
949534702 3:4986863-4986885 AAGGAGAGGTGGCAGGAGGCAGG + Intergenic
949724486 3:7027580-7027602 GTGGAGAGCCAGCAGAAGAGAGG - Intronic
949782047 3:7700808-7700830 AAGGACAGCCAGCAGCTGGCAGG + Intronic
950008444 3:9705620-9705642 GAGGAGAGGGACCAGGAGGGTGG - Intronic
950187055 3:10951737-10951759 AAGTTGAGGCAGCAGGAGTGTGG - Intergenic
950788357 3:15453765-15453787 AAGGAAAGCAAAGAGGAGGGAGG + Intronic
951417663 3:22444937-22444959 AAGGAGAGAAGGAAGGAGGGAGG + Intergenic
951569403 3:24046297-24046319 AAGAATAGCCAGCAGAAGTGAGG - Intergenic
952029299 3:29121291-29121313 AATGAGAGAGAGAAGGAGGGAGG + Intergenic
952097274 3:29968443-29968465 ACAGGGATCCAGCAGGAGGGTGG - Intronic
952623583 3:35376292-35376314 AAGGAGGGCCGGAGGGAGGGAGG + Intergenic
953357462 3:42266747-42266769 AAGGAGAGACGGAGGGAGGGAGG - Intergenic
953856506 3:46503415-46503437 AAGGAGAGCCAGCACAAGTAGGG + Intergenic
954082812 3:48222357-48222379 CAGGAGGGACAGCAGGAGAGTGG + Intergenic
954299821 3:49694878-49694900 CAGGAGAGACAGCAGGTGGTAGG + Intronic
954332827 3:49899991-49900013 GAGAAGAGCCAGCAGGGGGCAGG - Intronic
954397329 3:50299637-50299659 AGGCAGAGCCAGCTGGAGGCGGG - Intergenic
954614547 3:51962941-51962963 AAGGGCAGCCAGCATGAGGCTGG - Intronic
954629519 3:52040404-52040426 AAGGAGAGCTGGCGGGTGGGGGG + Intergenic
954643735 3:52117978-52118000 AAGAACAGACAGCAAGAGGGTGG + Intronic
955458235 3:59149339-59149361 CAGGAGACCCAGAAGGAGGATGG - Intergenic
955499810 3:59572625-59572647 AAGGAAGGCCTCCAGGAGGGGGG - Intergenic
955839451 3:63096610-63096632 AAGGAGAGCCGGCTGGAGTCTGG - Intergenic
956064194 3:65379599-65379621 AGGGAGGGGCAGCAGGATGGAGG - Intronic
957937980 3:86968764-86968786 GGGCAGAGCCAGCAGGAGGGTGG + Exonic
959279705 3:104323021-104323043 ACAGAGAGCCATCAGGAGGGTGG + Intergenic
959437211 3:106330613-106330635 AAACAGAACCAGCAGGAGGTAGG - Intergenic
959445732 3:106436356-106436378 AAGAAGAGAGAGAAGGAGGGAGG + Intergenic
959595985 3:108128899-108128921 AAGGAGAGGCAGAAGGAAGCAGG + Intergenic
960275819 3:115728105-115728127 ATGGAGAGACAGCATGAGGGAGG + Intergenic
960509069 3:118526277-118526299 AGGCAGAGCTAGCAGGAGGATGG + Intergenic
960574038 3:119211986-119212008 ATGAAGAGGTAGCAGGAGGGTGG - Exonic
961103417 3:124221109-124221131 AAGGAGTGCATGGAGGAGGGTGG - Intronic
961560607 3:127726253-127726275 AAAGAGAGAGAGAAGGAGGGAGG + Intronic
962264423 3:133935131-133935153 AAGCAGAGCCAGAAGGAGAGAGG + Intronic
963290090 3:143478448-143478470 AGGCAGAGTCAGCAGGAGGCTGG + Intronic
963394511 3:144715107-144715129 TAGGAAAGCAGGCAGGAGGGAGG - Intergenic
963478099 3:145832266-145832288 AAGGAGAGAAAGCAAGAGAGAGG + Intergenic
963989026 3:151631824-151631846 AAGGAGAGGCAGGAGGAGCCAGG + Intergenic
964673782 3:159255243-159255265 AAGGAGAGCCTTCAGGAGAGGGG - Intronic
964738597 3:159942141-159942163 AAGGAGAGAGAGAAGGAGGGAGG + Intergenic
964762465 3:160147193-160147215 AAGGGGAGACAGAGGGAGGGAGG - Intergenic
964802268 3:160568986-160569008 TAGGAGAGCCAGCTGGAGTCTGG + Intergenic
965355411 3:167667245-167667267 AAGGAGGGAGAGAAGGAGGGAGG + Intergenic
965367357 3:167817037-167817059 AGGGAGAGCAAGCAGGAGAGGGG + Intronic
965422787 3:168482800-168482822 CAGGAAAGCCAGCAGGAATGTGG - Intergenic
965749309 3:171959747-171959769 GCTGAGAGTCAGCAGGAGGGAGG + Intergenic
966248404 3:177834477-177834499 AAGGAGAACAAAGAGGAGGGTGG + Intergenic
966735335 3:183182559-183182581 TAGGAGACAAAGCAGGAGGGGGG + Intronic
967824877 3:193869917-193869939 GAGGAGGGCCGGCTGGAGGGAGG + Intergenic
968358484 3:198128001-198128023 AAGGAGATTCAGCAGGAAGATGG - Intergenic
968566811 4:1317416-1317438 GACAAGAGCCAGCAAGAGGGTGG - Intronic
968628590 4:1638803-1638825 AAGGACAGGCAGGAGGAGGGGGG - Intronic
968744438 4:2352393-2352415 AAGGGGAGATAGGAGGAGGGAGG + Intronic
969207128 4:5655464-5655486 GAGGAGAGACTGCAGGAGGCTGG - Intronic
969272801 4:6114262-6114284 AAGGAGAGAAAGCACCAGGGAGG + Intronic
969479533 4:7440695-7440717 GAGGAGAGGCAGCATGAGGGTGG - Intronic
970195577 4:13547597-13547619 GAGGAGAAGCAGGAGGAGGGAGG - Intergenic
970273164 4:14368493-14368515 ATGGAGAGCCAGAAGGGGGATGG + Intergenic
970304642 4:14718785-14718807 AGGGAGGGCTAGCAGGAGGGTGG + Intergenic
971394283 4:26214302-26214324 AAGGAGACAGAGAAGGAGGGAGG + Intronic
971500264 4:27311453-27311475 AGGGAGATCTAGAAGGAGGGAGG + Intergenic
972246161 4:37247030-37247052 TAGGAAAGCAAACAGGAGGGAGG + Intronic
972380929 4:38519706-38519728 AAAGAGACTCAGCTGGAGGGAGG + Intergenic
972648726 4:40994855-40994877 AAGGAGAGAGAGAAGGAGGGAGG + Intronic
975382131 4:73713253-73713275 AAGGATAGCTAGAAGGAGAGAGG + Intergenic
975504426 4:75122675-75122697 AAGGAGGGAGAGGAGGAGGGAGG + Intergenic
975660323 4:76682023-76682045 AAGGAGAGCCAGAGGGAAAGTGG - Intronic
975826070 4:78320648-78320670 AGAGAGAGACAGAAGGAGGGAGG - Intronic
976201967 4:82587908-82587930 GAGGAAAGGCAGCAAGAGGGCGG - Intergenic
976527211 4:86107571-86107593 AAGGAGAAACAGGAGAAGGGGGG + Intronic
976547423 4:86353041-86353063 AAGGATAGCCAGAGGAAGGGAGG - Intronic
976700821 4:87966824-87966846 AGGGACAGCCAGCAGCAGAGAGG + Intergenic
977589801 4:98813666-98813688 AAGGATGGCCTGCAGCAGGGTGG - Intergenic
979576517 4:122297905-122297927 CAGCAGGGACAGCAGGAGGGAGG + Intronic
980078601 4:128320465-128320487 AGGGAGAGAGAGAAGGAGGGGGG - Intergenic
980841060 4:138261913-138261935 AAGAAGAAACAGGAGGAGGGAGG - Intergenic
981775938 4:148367961-148367983 GAGGAAATACAGCAGGAGGGCGG - Intronic
982004235 4:151049249-151049271 TAGGAGAGCCAGAAGGAAGATGG + Intergenic
982298262 4:153852417-153852439 AAGGGGTGACAGCAGGTGGGAGG + Intergenic
983595122 4:169457681-169457703 AAGGAGAGAAAGAAGGGGGGAGG + Intronic
985035759 4:185838457-185838479 GAGGAGAGCCTGGAGGAGAGGGG + Intronic
985273455 4:188216325-188216347 AAGGAGAGAGGGAAGGAGGGAGG - Intergenic
985273489 4:188216424-188216446 AAGGAGAGAGGGAAGGAGGGAGG - Intergenic
985273500 4:188216456-188216478 AAGGAGAGAGGGAAGGAGGGAGG - Intergenic
985335134 4:188884241-188884263 CAGAAGAGCCAGCAGGATTGAGG - Intergenic
985440057 4:189976301-189976323 AAGGAGATTCAGCAGGAAGATGG + Intergenic
985445784 4:190020763-190020785 AAGGAGAGAAAGAGGGAGGGAGG - Intergenic
985487036 5:157832-157854 ATGGAGAGGCAGCAGTGGGGTGG + Intronic
985563843 5:605369-605391 GAGGAGAGCAAGCCAGAGGGGGG + Intergenic
985563852 5:605410-605432 GAGGAGAGCAAGCCAGAGGGGGG + Intergenic
985563868 5:605492-605514 GAGGAGAGCAAGCCAGAGGGGGG + Intergenic
985563884 5:605574-605596 GAGGAGAGCAAGCCAGAGGGGGG + Intergenic
985627227 5:995365-995387 AAGGACAGCCAGGTGGAGAGGGG - Intergenic
985670782 5:1205528-1205550 AAGGAGAGCCACCAGGAGCAAGG + Intronic
985819937 5:2152908-2152930 AAGGAGAGACAGAAGAAGAGAGG - Intergenic
985898072 5:2762239-2762261 GAGGGGAGGCAGCAGGAGGCTGG + Intergenic
986331076 5:6716457-6716479 AACAAGAGCCTGCATGAGGGAGG - Intronic
986490907 5:8289190-8289212 AAGGAGAGAGAGAAGGAAGGAGG + Intergenic
986533933 5:8766860-8766882 GAAGAGGGCCAGCAGGAGTGAGG + Intergenic
987081798 5:14431850-14431872 ATGGAGAATCAGCAAGAGGGTGG - Intronic
987602931 5:20095476-20095498 AAGGAGAGAGAGAGGGAGGGAGG + Intronic
988109968 5:26807547-26807569 AATAAGAGCCAGGAGCAGGGAGG - Intergenic
988187952 5:27890810-27890832 CAGGAGAGAGAGAAGGAGGGGGG - Intergenic
988205339 5:28126516-28126538 ATGGAGAGCCAGAAGGGGGATGG - Intergenic
988773073 5:34450999-34451021 AAGGAGAGAGAGAGGGAGGGAGG - Intergenic
988856091 5:35229572-35229594 AAGGAGAGCCCGCTGGAGAAGGG - Intronic
988861223 5:35281992-35282014 CTGGAGAGTCAGCAGGAGGAGGG + Intergenic
989332273 5:40274136-40274158 GAGGAGAGCTATCAGGAGGTAGG + Intergenic
990526483 5:56633170-56633192 AAGGAGGAGCAGGAGGAGGGAGG + Intergenic
990719617 5:58679174-58679196 AAGGAGAAGCAGCAGGGTGGGGG + Intronic
990755424 5:59064108-59064130 AAGGAAAGAGAGAAGGAGGGAGG + Intronic
991573228 5:68077161-68077183 AAGGAGAGCAAGGAGAAGAGGGG - Intergenic
992092040 5:73326036-73326058 GTGGAGAGGCAGCAAGAGGGTGG - Intergenic
992228338 5:74640418-74640440 AAGGAGGGCCAGCCGGGGAGAGG + Exonic
992295692 5:75324359-75324381 ATGGAGTGCCAGCCTGAGGGTGG - Intergenic
992829337 5:80579109-80579131 AAGGAGAGAGAGCGGGAGGGAGG + Intergenic
992904619 5:81334108-81334130 ATGGGGAGCCAGAAGGAGGATGG - Intronic
993192013 5:84695500-84695522 AAGGAAAGCCAGCAGTTGTGAGG + Intergenic
993407526 5:87529882-87529904 AAGGAGAGAGAGAAGGAGGGAGG - Intergenic
993765960 5:91858878-91858900 AAAGAGAGAGAGCACGAGGGGGG + Intergenic
993786636 5:92147065-92147087 ACTGAGAGCCAGCAGCAGGATGG + Intergenic
993899742 5:93577146-93577168 CAGGAGAAGCAGCAGGAGGAAGG - Intergenic
994510391 5:100696066-100696088 ATGGAGTGACAGCAGGAGAGTGG - Intergenic
994926274 5:106120949-106120971 GAGCAGAGCCAGAAGGCGGGAGG - Intergenic
996118211 5:119642547-119642569 GAGGAGAGGCAGAAGGATGGAGG - Intergenic
996511934 5:124326323-124326345 AAGGAGAGCCAGCCTTAGGGGGG - Intergenic
997281568 5:132651394-132651416 AAGGAAAGCCAGAAGGAGTGAGG - Intergenic
997737648 5:136225910-136225932 AAGGGGAGCCAGGAGCTGGGAGG - Intronic
997791442 5:136766002-136766024 AAGGGGAGGAAGCAGGAGGATGG - Intergenic
997854199 5:137358497-137358519 AAGGAGAGACAGAAGGGAGGAGG + Intronic
998197132 5:140083875-140083897 AAGGAGAGGCAACTGGAGAGAGG + Intergenic
998205500 5:140154338-140154360 AGGCAGAGCAAGCAGGAGTGGGG - Intergenic
998407861 5:141883944-141883966 AAGGAAAGAGAGGAGGAGGGAGG - Intergenic
999169450 5:149581258-149581280 AATGAGAGGCCGCGGGAGGGTGG + Intronic
999249089 5:150171183-150171205 AAGGTGAGACAGCAGGTTGGTGG - Intronic
999322496 5:150624298-150624320 AAGGAGAGCCAGGAAGAGGTAGG + Intronic
999943232 5:156567475-156567497 AGGGTGAGCCAGCAGGCTGGAGG + Intronic
1000383678 5:160652142-160652164 AAGGAGACACAGCAGGAGGAAGG - Intronic
1000838673 5:166188486-166188508 ACTGAGGGGCAGCAGGAGGGAGG + Intergenic
1001105356 5:168848750-168848772 AAGGAAAGCCAGCGTGAGTGAGG + Intronic
1001219073 5:169883651-169883673 AAGGAGAGCGAGTAGGTGGGGGG + Exonic
1001408708 5:171495295-171495317 AAGGAGGGACAGAGGGAGGGAGG + Intergenic
1001525658 5:172426806-172426828 AAGCAGAGCCAGAGGGAGAGAGG + Intronic
1001842219 5:174887652-174887674 AAGCAGAGGCAGCAGGAGCCAGG - Intergenic
1002001849 5:176200481-176200503 TAGGAGAGCCAGCAGCAGAGAGG + Intergenic
1002027580 5:176405965-176405987 ACGGAGGGCCAGCAGGTGTGGGG - Intronic
1002252489 5:177938497-177938519 TAGGAGAGCCAGCAGCAGAGAGG - Intergenic
1002466445 5:179411140-179411162 CAAGAGAGCCAGCAGGAGCCTGG + Intergenic
1002540914 5:179906366-179906388 GAGAAGAGCCCGCAGGAAGGAGG + Intronic
1002641434 5:180632397-180632419 AGGGAGAGCCCGGAGGAGGCTGG - Intronic
1002695790 5:181087453-181087475 GAGCAGGGACAGCAGGAGGGTGG + Intergenic
1002825375 6:768103-768125 AAGGAGAGAGGGAAGGAGGGAGG - Intergenic
1002910081 6:1483414-1483436 AAGGAGAGAGAGAGGGAGGGAGG + Intergenic
1003166108 6:3679933-3679955 AAGCAGAGCCTGCAGGAGCCAGG - Intergenic
1003315853 6:5011350-5011372 AAAGAGACACAGCAGGAGGAAGG + Intergenic
1004598727 6:17127008-17127030 AAGGAGAGCCTACAGCCGGGGGG - Intronic
1004910856 6:20281630-20281652 AAGTAGAGCAAGCAGAAGGAAGG + Intergenic
1004915900 6:20331883-20331905 AAAGAAAGCCAGAAGGAGGTTGG + Intergenic
1005224018 6:23620247-23620269 AGGGAGAGACAGAGGGAGGGAGG + Intergenic
1005608330 6:27498309-27498331 AAGGAGAACCCACAGGAAGGTGG - Intergenic
1005665046 6:28044169-28044191 AAAGAAAGGAAGCAGGAGGGAGG + Intergenic
1005845452 6:29773419-29773441 AAGGAGAGAAAGAAGGAGAGAGG - Intergenic
1006019804 6:31111437-31111459 AAGAAGAGCCAGGAGGGCGGAGG + Exonic
1006067873 6:31475344-31475366 AAGGAAAGCAGGCAGGAGTGAGG - Intergenic
1006149535 6:31979227-31979249 AAGGAGGGGGAGGAGGAGGGGGG + Intronic
1006289439 6:33123292-33123314 AAGGAGAGAAAACAGTAGGGAGG - Intergenic
1006446622 6:34083446-34083468 AAGGAGACCCAGCTGGCGCGTGG + Intronic
1006489751 6:34376968-34376990 AAGGAGACCCAGCATGATTGAGG - Intronic
1007063981 6:38970481-38970503 AATGAGAGCCTGAAGGAGGATGG - Intronic
1007419520 6:41711427-41711449 AATGAGCGCCAGCAGAATGGAGG + Intronic
1007745579 6:44041108-44041130 AAGGAGAGCAAGAAGGAGGGAGG + Intergenic
1008265143 6:49415691-49415713 AAGGAGAGAGAGAGGGAGGGAGG + Intergenic
1009305983 6:62089525-62089547 AAGGAGGGCGAGCAGAAGGAGGG - Intronic
1010028374 6:71245743-71245765 ATGGGGAGCCAGAAGGAGGATGG + Intergenic
1010704290 6:79089600-79089622 AAGGAAAGAAAGAAGGAGGGAGG - Intergenic
1011032144 6:82935215-82935237 AAGCAGAGCAAGCAAGAGAGAGG + Intronic
1011227723 6:85126519-85126541 AGGGGGAGCCAGCAGGAGCAAGG - Intergenic
1011509847 6:88088383-88088405 CAGGAGAACCTGCAGAAGGGAGG + Intergenic
1011741127 6:90361871-90361893 AAGGTGAGCCTGGAGGAGGTGGG - Intergenic
1012245753 6:96924390-96924412 CCGGAGAGCGAGGAGGAGGGCGG + Intergenic
1012831499 6:104209031-104209053 AAAGAAAGCCAGCAGGATGGGGG + Intergenic
1013374010 6:109496598-109496620 AAGGAGAGCCAGGATGAGGAGGG - Intronic
1013497467 6:110712673-110712695 TAGGGAAGCCAGCAGGAGTGTGG + Intronic
1014724004 6:124954264-124954286 AAGGAGAGAGAGGAGAAGGGAGG - Intergenic
1014726326 6:124976266-124976288 AAGGAGAGAGAGCGGGAGGGAGG - Intronic
1014856783 6:126411949-126411971 AAGGAGAGAGAGAGGGAGGGAGG - Intergenic
1015880293 6:137865382-137865404 AAGGAGCACCAGCAGGAGAGTGG + Intergenic
1016073811 6:139772668-139772690 AAGGAGAGGGAGAAGGAAGGAGG - Intergenic
1016921961 6:149304401-149304423 AGGGAGAGCCAGCAGGAAACTGG - Intronic
1017041134 6:150309327-150309349 AAGGAAAGACAGAAGGAAGGAGG + Intergenic
1017151427 6:151283944-151283966 AAGGAGAGCAAGCTGGAGGCAGG - Intronic
1017229154 6:152053401-152053423 AGGGAGAGACAGAAGGAGGAAGG - Intronic
1017494939 6:154975349-154975371 AAGGAGAAACACCTGGAGGGAGG + Intronic
1018038045 6:159898542-159898564 AGGAAGAGGCAGGAGGAGGGAGG - Intergenic
1018204184 6:161421483-161421505 AAGCAGGACCAGCATGAGGGTGG + Intronic
1019327620 7:446062-446084 AAGGAAAGGAAGAAGGAGGGAGG + Intergenic
1019439982 7:1041122-1041144 ATGGAGAGACTGCAGGAGGGAGG + Intronic
1019494967 7:1333460-1333482 AAGGAGGGGGAGGAGGAGGGAGG - Intergenic
1019688533 7:2396390-2396412 AAGGTGAGGCAGCATGAGAGGGG - Intergenic
1019705699 7:2496193-2496215 ATGCAGAGGCAGCAGGAGGGAGG + Intergenic
1020260754 7:6529597-6529619 ATGGAGGGCCAGCAGGAGCCAGG - Intronic
1021105329 7:16632056-16632078 AAGGAGAAAGAGAAGGAGGGAGG - Intronic
1021447490 7:20749144-20749166 AAGGAGAGAGAGAGGGAGGGAGG - Intronic
1021783917 7:24133994-24134016 GAGGAGAGCCCGCAGGAGATGGG - Intergenic
1021915358 7:25426104-25426126 AGTGAGAGCCAGCAGAAGTGGGG + Intergenic
1021939911 7:25669101-25669123 AAGGAGGGGTAGCAGGAAGGAGG - Intergenic
1021965561 7:25915009-25915031 AAGGAGACCCAGAAGGAGTGGGG - Intergenic
1022594204 7:31696509-31696531 GAGGTGAGAAAGCAGGAGGGCGG + Intronic
1022657263 7:32330950-32330972 AAGGAGACAGAGGAGGAGGGAGG - Intergenic
1023254597 7:38300439-38300461 AAGCAGGGTGAGCAGGAGGGGGG - Intergenic
1023616167 7:42022498-42022520 AAAGAGAGAGAGCAGGAGGAGGG + Intronic
1023842630 7:44105666-44105688 AAGGAGAGCCAGAGGCAGGAGGG - Intronic
1023879912 7:44312462-44312484 AAGGAGAGGGAGGAAGAGGGAGG + Intronic
1023991703 7:45132584-45132606 AAGGAGAGAGGGGAGGAGGGAGG + Intergenic
1025198743 7:56949553-56949575 AAGGGGAGGGAGGAGGAGGGGGG - Intergenic
1025830600 7:65045888-65045910 AAGGAAAGGAAGAAGGAGGGTGG - Intergenic
1025917755 7:65879674-65879696 AAGGAAAGGAAGAAGGAGGGTGG - Intronic
1026191869 7:68136285-68136307 AAGGAGAAAGAGAAGGAGGGGGG + Intergenic
1026305294 7:69134994-69135016 AAGGAGAGGGAGAAGGAGAGAGG - Intergenic
1026313925 7:69211683-69211705 ATGGGGAGCCAGAAGGAGGGTGG - Intergenic
1026353111 7:69534667-69534689 AATGTGAGTCAGCAGGAGCGGGG + Intergenic
1026517818 7:71087876-71087898 AAGGAGTGGCAGGAGGAGGCGGG + Intergenic
1026650020 7:72209025-72209047 AAGGAGAGAGAGAAGGAAGGAGG - Intronic
1026828916 7:73600007-73600029 AAGGGGAGCCACCAGGGGGTGGG - Intronic
1026837259 7:73647375-73647397 AGGGAGAGCCAGAGGGAGGAAGG + Intergenic
1027416868 7:77983341-77983363 AAAGAGAGACAGAGGGAGGGAGG - Intergenic
1027824111 7:83088816-83088838 AAGGAGAGGCCTCAGGAGGGAGG - Intronic
1028128566 7:87143813-87143835 AATGACAGCAAGCAGGAGGCTGG - Intergenic
1029144982 7:98439349-98439371 AAAGAAAGACAGAAGGAGGGAGG - Intergenic
1029358748 7:100072635-100072657 GAGGAGAGACAGCAGCAGCGCGG + Intronic
1029704403 7:102268467-102268489 GAGAAGAGGCAGCAGGAGGCAGG - Intronic
1030811946 7:113983379-113983401 AAGGAGAGAGAGAGGGAGGGAGG - Intronic
1031008814 7:116502237-116502259 CAGAAGAGCCAGCTGGAGAGAGG - Intronic
1031232308 7:119123647-119123669 ATGGGGAGCCAGCAGGGGGATGG - Intergenic
1032367629 7:131315262-131315284 ATGGAGAGCAAGCAGAAGGGTGG + Intronic
1033234423 7:139626830-139626852 AAGGGGAGCCAGGAGAGGGGAGG - Intronic
1033259583 7:139831244-139831266 GAGCAGAGGCAGCAGGAGAGAGG + Intronic
1033349714 7:140552356-140552378 AAGGAGAGGGAGAGGGAGGGAGG - Intronic
1033398318 7:140996593-140996615 TAGGAGAGACAGAAGGATGGAGG - Intergenic
1033537933 7:142329026-142329048 AGGGAGAGACAACATGAGGGTGG - Intergenic
1033537951 7:142329091-142329113 CAGGAGAGACAACATGAGGGTGG - Intergenic
1034306341 7:150047861-150047883 AAAGACAGCCAGCAGGAGCGCGG - Intergenic
1034456863 7:151175379-151175401 CAGGAGAGCCACCCGGAAGGAGG - Intergenic
1034550076 7:151814881-151814903 ACAGCAAGCCAGCAGGAGGGAGG + Intronic
1034550085 7:151814923-151814945 AAAGACAGGCAGCAGGATGGAGG + Intronic
1034800507 7:154052792-154052814 AAAGACAGCCAGCAGGAGCGCGG + Intronic
1035032215 7:155868876-155868898 AAGGAGAGCCAGGAGGGCAGAGG + Intergenic
1035195931 7:157220505-157220527 AAGGACAGCTAGCATGAGAGAGG + Intronic
1035767431 8:2118627-2118649 AGGAAGATCCAGCAGCAGGGAGG + Intronic
1036659282 8:10697668-10697690 ACAGAGGGCCAGCAGGTGGGTGG - Exonic
1036744064 8:11391512-11391534 AAGGAGTTCCAGAAGGAGGACGG - Intronic
1037206059 8:16321138-16321160 TGGGAGAGCAACCAGGAGGGGGG + Intronic
1037595029 8:20347841-20347863 CAGGAGAGACAGCAAGAAGGGGG + Intergenic
1037656166 8:20886024-20886046 AAAGAGAGACAGAGGGAGGGAGG + Intergenic
1037881480 8:22575420-22575442 GGGGAGAGCCAGCAGGCAGGCGG - Exonic
1037893205 8:22635040-22635062 CAGGAGAGGCAGCAGGAGGGTGG - Intronic
1038448423 8:27620789-27620811 AGGGAGAGCCAGAGGGAGGGAGG - Intergenic
1038450278 8:27634802-27634824 GTGGTGAGCCAGCAGCAGGGTGG + Intronic
1038562386 8:28591414-28591436 AAAGCGAGCAAGCAGCAGGGAGG - Intergenic
1038739476 8:30204301-30204323 AAGGTGAGACAGCTGGAAGGTGG + Intergenic
1038854674 8:31318416-31318438 AAGCTGAGACAGCAGGATGGAGG + Intergenic
1039714717 8:40095040-40095062 AAGGGGAGGCACCAGGAGGCAGG - Intergenic
1039819925 8:41126351-41126373 AAGGAGGGGCAGCGGCAGGGTGG - Intergenic
1040517132 8:48144448-48144470 GGGGAGGGCCCGCAGGAGGGTGG + Intergenic
1041315529 8:56558108-56558130 AAGGAGATAGAGCAGGAGGGCGG - Intergenic
1041866670 8:62582084-62582106 AAGGAAAGACAGAAGGAGGGAGG - Intronic
1041946574 8:63450379-63450401 AAGGAGCCCAAGCAGGAGGTAGG + Intergenic
1041965174 8:63667765-63667787 CAGGAAAGCAACCAGGAGGGGGG + Intergenic
1042701579 8:71621208-71621230 TAGGAGAGCCATAAGAAGGGAGG - Intergenic
1042814607 8:72864976-72864998 AATGAGGCCCAGCAGGAGGTTGG - Intronic
1044199030 8:89412855-89412877 GAGGAGAGCCAGCTGGAGTCTGG - Intergenic
1044779596 8:95730494-95730516 AAGGAGGCCGAGCAGGAGTGGGG - Intergenic
1044802999 8:95976262-95976284 AAGGAGAGAGAGAAGGATGGAGG + Intergenic
1044852012 8:96437798-96437820 AGGAAGAGACAGCAGAAGGGAGG + Intergenic
1045025228 8:98080702-98080724 AAGGAGAGGGAGGGGGAGGGGGG - Intronic
1046092951 8:109524828-109524850 AAGGAAGGACAGAAGGAGGGAGG - Intronic
1046756940 8:117981898-117981920 AAGGAGGGAGAGAAGGAGGGAGG + Intronic
1046779622 8:118201233-118201255 ATGCAGAGCCAGAAGGAGGCTGG - Intronic
1047248559 8:123165046-123165068 AAGGAGACCCAGGAGGAAGGCGG + Intergenic
1047518668 8:125577712-125577734 AAGAAGAGACAGAGGGAGGGAGG - Intergenic
1047766482 8:127994128-127994150 AAGGAGAGACAGTTGGAGAGGGG - Intergenic
1047898652 8:129396142-129396164 AAAGAGAGCGAGAGGGAGGGAGG + Intergenic
1048146620 8:131851244-131851266 AAGGAGAGAAAGCATCAGGGGGG - Intergenic
1048737112 8:137514184-137514206 AAGATGAGCCATCTGGAGGGAGG + Intergenic
1048848791 8:138624462-138624484 AAGGAAAGAAAGGAGGAGGGAGG + Intronic
1048878718 8:138856674-138856696 CAGGAGAGACAGCAAGAGAGAGG + Intronic
1048879395 8:138860143-138860165 AATGTGAGCCAGCAGGAAGCTGG - Intronic
1048899522 8:139024210-139024232 GAGGAGAGCCACCAGGAGTCAGG + Intergenic
1048988735 8:139749149-139749171 ACAGGGAGTCAGCAGGAGGGAGG - Intronic
1049003967 8:139843275-139843297 TCCCAGAGCCAGCAGGAGGGCGG + Intronic
1049056040 8:140238405-140238427 AAGGAGACCCAGCACCAGGAAGG + Intronic
1049336424 8:142089089-142089111 AAGGAGAAGCAGCCTGAGGGTGG + Intergenic
1049373596 8:142279016-142279038 AAGGCCAGCCAGCAGGTGGGAGG - Intronic
1049410129 8:142470188-142470210 AGAGAGAGCCGGCAGGAGAGGGG - Intronic
1049410574 8:142472140-142472162 AGGGAGGCCCAGCTGGAGGGAGG + Intronic
1049475258 8:142794313-142794335 AGGGAGAGGCAGAGGGAGGGTGG - Intergenic
1049558185 8:143294087-143294109 CAGGAGGGGCAGCAGGAGGAGGG - Intronic
1049601967 8:143512139-143512161 AAGGAGAGCGAGCAGGGAAGGGG + Intronic
1049763220 8:144340171-144340193 AAGGAGGGCCCTCAGCAGGGAGG + Intergenic
1050299058 9:4238226-4238248 AAGGAAGGCCAAAAGGAGGGAGG + Intronic
1050479527 9:6075400-6075422 AAAGAGAGCCTGGAGGAGGGAGG - Intergenic
1050579724 9:7040302-7040324 AAAGAGAGACAGAGGGAGGGAGG - Intronic
1050744271 9:8858203-8858225 AAGAAGAGGCAGCAGGAAGGAGG - Intronic
1051129265 9:13841325-13841347 AAGGAGGGAGAGCAGGAAGGAGG + Intergenic
1051129271 9:13841345-13841367 AGGGAGAGAAAGGAGGAGGGAGG + Intergenic
1052696163 9:31881748-31881770 AAATAGAGCCAGGAGGAAGGGGG - Intergenic
1053280785 9:36818738-36818760 GAGGAGAGACAGCTGGAGAGAGG - Intergenic
1053580537 9:39399438-39399460 AAGGAGAGAGAGAGGGAGGGAGG - Intergenic
1053696841 9:40647385-40647407 CAGGACAGCCCGAAGGAGGGGGG + Intergenic
1053817456 9:41927528-41927550 AAGGAGAGAAAGAGGGAGGGAGG + Intronic
1054102124 9:60958243-60958265 AAGGAGAGAGAGAGGGAGGGAGG - Intergenic
1054308092 9:63446618-63446640 CAGGACAGCCCGAAGGAGGGGGG + Intergenic
1054406825 9:64770609-64770631 CAGGACAGCCCGAAGGAGGGGGG + Intergenic
1054440450 9:65256075-65256097 CAGGACAGCCCGAAGGAGGGGGG + Intergenic
1054489957 9:65765849-65765871 CAGGACAGCCCGAAGGAGGGGGG - Intergenic
1054584235 9:66948620-66948642 AAGGAGAGAGAGAGGGAGGGAGG + Intergenic
1054764147 9:69029007-69029029 AGGAAGAGGCAGCAAGAGGGCGG - Intergenic
1055099246 9:72446284-72446306 AAGGAGAGAAAGAAGTAGGGAGG - Intergenic
1056327355 9:85490915-85490937 ATGGGGAGCCAGAAGGAGGATGG - Intergenic
1056422495 9:86442952-86442974 AAGGAAAGAGAGAAGGAGGGAGG - Intergenic
1056617457 9:88180597-88180619 AAGGAGGGCCAGCGGGAGGGCGG - Intergenic
1056644567 9:88399567-88399589 AAGGAGAGCCCAGAGGAAGGTGG + Intronic
1056691310 9:88810921-88810943 AAGGAGAGAAAGCCTGAGGGTGG - Intergenic
1056755155 9:89377013-89377035 AAGAGGAGCCAGGAGGAGGGAGG + Exonic
1056850487 9:90079900-90079922 AAGGAGAGCTGGCAGTAGGGAGG - Intergenic
1057026341 9:91736615-91736637 GAGTAGAGACAGCAGGAGGAGGG + Intronic
1057134499 9:92677919-92677941 AAAGAGAGGCAGGTGGAGGGTGG - Intergenic
1057388210 9:94622669-94622691 AAAGAGAAGCAGCAGGAGGAGGG - Intronic
1057438679 9:95065485-95065507 AAGGGCAGCCAGCAGGAGAAGGG - Intronic
1057501943 9:95603090-95603112 AAGGAGAGAAGGAAGGAGGGTGG - Intergenic
1057565052 9:96160100-96160122 AAGGAGAGAGAGAGGGAGGGAGG + Intergenic
1057748067 9:97767608-97767630 AAGGAGAGAGAGGAGGAAGGAGG - Intergenic
1058176216 9:101738515-101738537 TGGGGGAGCCTGCAGGAGGGTGG - Exonic
1058560966 9:106228852-106228874 CAGGGGAGCCAGCAGAAAGGAGG - Intergenic
1058950921 9:109903152-109903174 ATGGTGAGCCAGCCGCAGGGAGG + Intronic
1059014354 9:110498343-110498365 AAGGAGTTCCAGAAGGAGAGAGG - Intronic
1059443903 9:114326325-114326347 AAGGAGAGGAAACAGGAGGAGGG + Exonic
1059445110 9:114333102-114333124 AAGGAGAGGAAACAGGAGGAGGG + Exonic
1059549550 9:115215191-115215213 AAGGAGAGTCAGCAGCTGTGAGG - Intronic
1059701923 9:116783341-116783363 AAGGAGAGAGAGAGGGAGGGAGG - Intronic
1059786998 9:117596914-117596936 AAGGAGAGTCAGCTAGTGGGAGG - Intergenic
1059929861 9:119249951-119249973 AAGGAGAGAGAGAGGGAGGGAGG + Intronic
1059929886 9:119250039-119250061 AAGGAGAGAGAGAGGGAGGGAGG + Intronic
1059965515 9:119609847-119609869 AAAGAGAGAGAGAAGGAGGGAGG - Intergenic
1060034112 9:120240368-120240390 CTGAAGAGCCAGCAGGAGGGGGG + Intergenic
1060222493 9:121772102-121772124 AGGGAGCGGCAGCAGGAGGCTGG + Intronic
1060297736 9:122354787-122354809 CAGCAGGGCCAGCAGGAGGCTGG + Intergenic
1060522249 9:124300486-124300508 CAGGTGAGACAGCAGGAGGCGGG + Intronic
1060546537 9:124465176-124465198 AAGGAGAGAGACCAGGAGGATGG - Intronic
1060561450 9:124548130-124548152 AAGAAGAGCAAGGGGGAGGGGGG + Intronic
1060662163 9:125410890-125410912 AGCGAGGGCCGGCAGGAGGGAGG + Intergenic
1060809656 9:126604202-126604224 ATGGAGAGCCAAGGGGAGGGAGG + Intergenic
1061234449 9:129334454-129334476 ATGCAGAGCTAGGAGGAGGGCGG + Intergenic
1061996611 9:134189353-134189375 AGGGAGAGACAGAAGGAGAGTGG + Intergenic
1062028760 9:134352569-134352591 AAGCGGGGCCAGCAGGAGGCTGG - Intronic
1062053663 9:134459738-134459760 CCACAGAGCCAGCAGGAGGGAGG - Intergenic
1062070331 9:134552023-134552045 GAGCAGAGTCAGCAGGAGGTGGG - Intergenic
1062437087 9:136551137-136551159 GAGGAGAGACATCAGGAGGATGG + Intergenic
1062473021 9:136714496-136714518 GAGGACAGCCAGGAGGAGGGAGG - Intronic
1062564672 9:137158871-137158893 AAGCAGAGAGAACAGGAGGGAGG + Intronic
1062596165 9:137300761-137300783 AGGGAGAGGGAGAAGGAGGGAGG + Exonic
1202779293 9_KI270717v1_random:21044-21066 CAGGACAGCCCGAAGGAGGGGGG + Intergenic
1203441894 Un_GL000219v1:16440-16462 CAGGACAGCCAGGAGGAGAGAGG - Intergenic
1203364376 Un_KI270442v1:244017-244039 AAGGAGAGAGGGAAGGAGGGAGG + Intergenic
1203512702 Un_KI270741v1:135349-135371 CAGGACAGCCAGGAGGAGAGAGG - Intergenic
1203617107 Un_KI270749v1:75774-75796 CAGGACAGCCCGAAGGAGGGGGG - Intergenic
1185643586 X:1601324-1601346 CAGGCGGGCCAGCAGCAGGGAGG + Exonic
1185999230 X:4989375-4989397 AGGAAGAGACAGAAGGAGGGAGG - Intergenic
1186079279 X:5912854-5912876 AGGGAGGGAGAGCAGGAGGGAGG + Intronic
1186204356 X:7185945-7185967 AACAAAAGCCAACAGGAGGGAGG - Intergenic
1186281650 X:7999412-7999434 AAGGAGAGCAATCAGGTGGCCGG + Intergenic
1186313163 X:8342079-8342101 GAGGAGAAGCAGGAGGAGGGAGG - Intergenic
1186618770 X:11215536-11215558 AAGGAGAGCTATCGGGATGGTGG - Intronic
1187077287 X:15947779-15947801 AAGTGTAGCCAGCAGCAGGGTGG + Intergenic
1187281584 X:17861382-17861404 GAGGAGGGGGAGCAGGAGGGGGG + Intergenic
1187338795 X:18403276-18403298 ATGGAGAGAAGGCAGGAGGGAGG + Intergenic
1187607076 X:20896748-20896770 CAGGAAAGCCAACAGGAAGGTGG - Intergenic
1188095606 X:26017391-26017413 CTGCAGAGCCAGCAGGAGTGAGG + Intergenic
1188404668 X:29792626-29792648 CAGAAGAGCCACCTGGAGGGTGG + Intronic
1188626657 X:32293414-32293436 GAAGAGAACCAGAAGGAGGGAGG + Intronic
1189288097 X:39866409-39866431 CAGGAGAGGCAGGAGGTGGGAGG + Intergenic
1189716716 X:43874593-43874615 AAGGAAAGTTAGTAGGAGGGGGG - Intronic
1190057415 X:47189793-47189815 AAGGAGAGGGAGAGGGAGGGTGG - Intergenic
1190260396 X:48793533-48793555 GAGGAGAGGAAGGAGGAGGGCGG - Intronic
1190283505 X:48946862-48946884 AAGGAGATCAAACAGGAGAGGGG + Intronic
1190619076 X:52266989-52267011 AAGGGGAGCCAGAGGGAGGAAGG + Intergenic
1190637099 X:52446146-52446168 AAGGGGAGCCAGAGGGAGGAAGG - Intergenic
1190981840 X:55463339-55463361 AAGGAGAGAAATGAGGAGGGAGG + Intergenic
1190986858 X:55509841-55509863 AAGGAGAGAAATGAGGAGGGAGG - Intergenic
1192098515 X:68239071-68239093 ATGGGGAGCCAGAAGGAGGATGG + Intronic
1192172913 X:68867860-68867882 ACGGGAGGCCAGCAGGAGGGCGG - Intergenic
1192199975 X:69060566-69060588 AAGGAGAGCCAGCAGGCTTTGGG + Intergenic
1192362856 X:70450143-70450165 AGCGGGAGCCAGCAGGAGGTGGG - Intronic
1192452170 X:71251433-71251455 AAGGAGAGTTAGGAGGAGGGAGG - Intronic
1192970335 X:76221769-76221791 ACAGAGATCCATCAGGAGGGTGG - Intergenic
1193112771 X:77746143-77746165 AAGGTGAGAGAGCAGGAGGTGGG + Intronic
1193169757 X:78321972-78321994 GAGGAGTGCCAACAGGAGTGGGG + Intronic
1194638915 X:96378514-96378536 AAGGAGAAACAAAAGGAGGGTGG + Intergenic
1195285342 X:103377284-103377306 AAGGGGAGAAAGCTGGAGGGAGG + Intronic
1196124222 X:112082347-112082369 AAGGAGAGGGAGAAGGAGGGAGG + Exonic
1197661652 X:129179756-129179778 AGGGAGAGCCAGCAGTTGTGAGG - Intergenic
1198383392 X:136105123-136105145 GAGGAGAGAGAGGAGGAGGGAGG + Intergenic
1199296480 X:146164641-146164663 AGGGAGAGACAGAGGGAGGGAGG + Intergenic
1200128267 X:153828451-153828473 AAGGAGACCCGCCAGGAGGAGGG - Intronic
1200165863 X:154034684-154034706 AAGGGGAGCCACCAGCAGAGTGG + Intronic
1200210534 X:154344989-154345011 GAGGACAGCCAGCAGGCAGGTGG - Intergenic
1200220318 X:154387103-154387125 GAGGACAGCCAGCAGGCAGGTGG + Intergenic
1200738854 Y:6831504-6831526 AAGGAGGGAGAGAAGGAGGGAGG - Intergenic
1201194569 Y:11479325-11479347 CAGGACAGCCCGAAGGAGGGGGG + Intergenic
1201452983 Y:14136195-14136217 AAGGAGAGAGGGAAGGAGGGAGG - Intergenic