ID: 1154146415

View in Genome Browser
Species Human (GRCh38)
Location 18:11869832-11869854
Sequence TTACTGTAACCTCCGCCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 359377
Summary {0: 51, 1: 2661, 2: 48075, 3: 164181, 4: 144409}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154146415_1154146416 8 Left 1154146415 18:11869832-11869854 CCAGGAGGCGGAGGTTACAGTAA 0: 51
1: 2661
2: 48075
3: 164181
4: 144409
Right 1154146416 18:11869863-11869885 TGCATCACTGCACGTCAGTCTGG 0: 1
1: 4
2: 206
3: 3971
4: 36799
1154146415_1154146417 9 Left 1154146415 18:11869832-11869854 CCAGGAGGCGGAGGTTACAGTAA 0: 51
1: 2661
2: 48075
3: 164181
4: 144409
Right 1154146417 18:11869864-11869886 GCATCACTGCACGTCAGTCTGGG 0: 1
1: 8
2: 323
3: 6906
4: 66795
1154146415_1154146419 19 Left 1154146415 18:11869832-11869854 CCAGGAGGCGGAGGTTACAGTAA 0: 51
1: 2661
2: 48075
3: 164181
4: 144409
Right 1154146419 18:11869874-11869896 ACGTCAGTCTGGGCGACAGAGGG 0: 1
1: 2
2: 119
3: 2525
4: 8044
1154146415_1154146418 18 Left 1154146415 18:11869832-11869854 CCAGGAGGCGGAGGTTACAGTAA 0: 51
1: 2661
2: 48075
3: 164181
4: 144409
Right 1154146418 18:11869873-11869895 CACGTCAGTCTGGGCGACAGAGG 0: 1
1: 2
2: 126
3: 2724
4: 8974

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154146415 Original CRISPR TTACTGTAACCTCCGCCTCC TGG (reversed) Intronic
Too many off-targets to display for this crispr