ID: 1154146418

View in Genome Browser
Species Human (GRCh38)
Location 18:11869873-11869895
Sequence CACGTCAGTCTGGGCGACAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 11827
Summary {0: 1, 1: 2, 2: 126, 3: 2724, 4: 8974}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154146415_1154146418 18 Left 1154146415 18:11869832-11869854 CCAGGAGGCGGAGGTTACAGTAA 0: 51
1: 2661
2: 48075
3: 164181
4: 144409
Right 1154146418 18:11869873-11869895 CACGTCAGTCTGGGCGACAGAGG 0: 1
1: 2
2: 126
3: 2724
4: 8974
1154146414_1154146418 19 Left 1154146414 18:11869831-11869853 CCCAGGAGGCGGAGGTTACAGTA 0: 32
1: 1538
2: 28382
3: 127258
4: 231496
Right 1154146418 18:11869873-11869895 CACGTCAGTCTGGGCGACAGAGG 0: 1
1: 2
2: 126
3: 2724
4: 8974

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154146418 Original CRISPR CACGTCAGTCTGGGCGACAG AGG Intronic
Too many off-targets to display for this crispr