ID: 1154148216

View in Genome Browser
Species Human (GRCh38)
Location 18:11884464-11884486
Sequence CTTTCTGGTTTGAACTTGCT CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 638
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 602}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154148216_1154148220 17 Left 1154148216 18:11884464-11884486 CCGAGCAAGTTCAAACCAGAAAG 0: 1
1: 0
2: 1
3: 34
4: 602
Right 1154148220 18:11884504-11884526 GCCCAAAGTGAGTGAGTGTGAGG 0: 1
1: 0
2: 3
3: 22
4: 226
1154148216_1154148223 26 Left 1154148216 18:11884464-11884486 CCGAGCAAGTTCAAACCAGAAAG 0: 1
1: 0
2: 1
3: 34
4: 602
Right 1154148223 18:11884513-11884535 GAGTGAGTGTGAGGACCACAAGG 0: 1
1: 0
2: 2
3: 26
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154148216 Original CRISPR CTTTCTGGTTTGAACTTGCT CGG (reversed) Exonic