ID: 1154148219 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 18:11884479-11884501 |
Sequence | CTAGCCTCACCTTTTCTTTC TGG (reversed) |
Strand | - |
Crispr in exon? | Yes |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 259 | |||
Summary | {0: 1, 1: 0, 2: 1, 3: 18, 4: 239} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1154148219_1154148223 | 11 | Left | 1154148219 | 18:11884479-11884501 | CCAGAAAGAAAAGGTGAGGCTAG | 0: 1 1: 0 2: 1 3: 18 4: 239 |
||
Right | 1154148223 | 18:11884513-11884535 | GAGTGAGTGTGAGGACCACAAGG | 0: 1 1: 0 2: 2 3: 26 4: 243 |
||||
1154148219_1154148220 | 2 | Left | 1154148219 | 18:11884479-11884501 | CCAGAAAGAAAAGGTGAGGCTAG | 0: 1 1: 0 2: 1 3: 18 4: 239 |
||
Right | 1154148220 | 18:11884504-11884526 | GCCCAAAGTGAGTGAGTGTGAGG | 0: 1 1: 0 2: 3 3: 22 4: 226 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1154148219 | Original CRISPR | CTAGCCTCACCTTTTCTTTC TGG (reversed) | Exonic | ||