ID: 1154148219

View in Genome Browser
Species Human (GRCh38)
Location 18:11884479-11884501
Sequence CTAGCCTCACCTTTTCTTTC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 239}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154148219_1154148223 11 Left 1154148219 18:11884479-11884501 CCAGAAAGAAAAGGTGAGGCTAG 0: 1
1: 0
2: 1
3: 18
4: 239
Right 1154148223 18:11884513-11884535 GAGTGAGTGTGAGGACCACAAGG 0: 1
1: 0
2: 2
3: 26
4: 243
1154148219_1154148220 2 Left 1154148219 18:11884479-11884501 CCAGAAAGAAAAGGTGAGGCTAG 0: 1
1: 0
2: 1
3: 18
4: 239
Right 1154148220 18:11884504-11884526 GCCCAAAGTGAGTGAGTGTGAGG 0: 1
1: 0
2: 3
3: 22
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154148219 Original CRISPR CTAGCCTCACCTTTTCTTTC TGG (reversed) Exonic