ID: 1154148223

View in Genome Browser
Species Human (GRCh38)
Location 18:11884513-11884535
Sequence GAGTGAGTGTGAGGACCACA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 272
Summary {0: 1, 1: 0, 2: 2, 3: 26, 4: 243}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154148216_1154148223 26 Left 1154148216 18:11884464-11884486 CCGAGCAAGTTCAAACCAGAAAG 0: 1
1: 0
2: 1
3: 34
4: 602
Right 1154148223 18:11884513-11884535 GAGTGAGTGTGAGGACCACAAGG 0: 1
1: 0
2: 2
3: 26
4: 243
1154148219_1154148223 11 Left 1154148219 18:11884479-11884501 CCAGAAAGAAAAGGTGAGGCTAG 0: 1
1: 0
2: 1
3: 18
4: 239
Right 1154148223 18:11884513-11884535 GAGTGAGTGTGAGGACCACAAGG 0: 1
1: 0
2: 2
3: 26
4: 243

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154148223 Original CRISPR GAGTGAGTGTGAGGACCACA AGG Exonic