ID: 1154157900

View in Genome Browser
Species Human (GRCh38)
Location 18:11958452-11958474
Sequence AACTGATATCAGGAGTAGGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154157892_1154157900 16 Left 1154157892 18:11958413-11958435 CCTAGCCAAATAAAGCTTTTTTA No data
Right 1154157900 18:11958452-11958474 AACTGATATCAGGAGTAGGGCGG No data
1154157891_1154157900 24 Left 1154157891 18:11958405-11958427 CCTGTAATCCTAGCCAAATAAAG No data
Right 1154157900 18:11958452-11958474 AACTGATATCAGGAGTAGGGCGG No data
1154157893_1154157900 11 Left 1154157893 18:11958418-11958440 CCAAATAAAGCTTTTTTATTAGG No data
Right 1154157900 18:11958452-11958474 AACTGATATCAGGAGTAGGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154157900 Original CRISPR AACTGATATCAGGAGTAGGG CGG Intergenic
No off target data available for this crispr