ID: 1154162187

View in Genome Browser
Species Human (GRCh38)
Location 18:11989040-11989062
Sequence TGGATTTGCACCCAAGCTGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 136}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154162187 Original CRISPR TGGATTTGCACCCAAGCTGA CGG Intronic
901960810 1:12825206-12825228 GGGATTTCCACAGAAGCTGAAGG + Exonic
901967407 1:12879808-12879830 GGGATTTCCACAGAAGCTGAAGG + Exonic
901975204 1:12938939-12938961 GGGATTTCCACAGAAGCTGAAGG + Exonic
901982807 1:13050072-13050094 GGGATTTCCACAGAAGCTGAAGG + Intronic
901986215 1:13077266-13077288 GGGATTTCCACAGAAGCTGAAGG - Exonic
901995597 1:13149501-13149523 GGGATTTCCACAGAAGCTGAAGG + Intergenic
901999282 1:13178846-13178868 GGGATTTCCACAGAAGCTGAAGG - Intergenic
902009971 1:13262825-13262847 GGGATTTCCACAGAAGCTGAAGG - Exonic
902017767 1:13321978-13322000 GGGATTTCCACAGAAGCTGAAGG - Exonic
902030832 1:13420972-13420994 GGGATTTCCACGGAAGCTGAAGG - Exonic
902123956 1:14192907-14192929 TGGATTAGCACCCACTCTAATGG - Intergenic
903268943 1:22175876-22175898 TGTAATTCCAACCAAGCTGAGGG + Intergenic
904940189 1:34160300-34160322 TCCATTTGCAATCAAGCTGAGGG - Intronic
907663135 1:56411919-56411941 AGTATTTCCACCGAAGCTGATGG + Intergenic
907806905 1:57829738-57829760 GAGATTTCCACCCCAGCTGAAGG + Intronic
909889502 1:80986320-80986342 TGGATTTAGACCAGAGCTGAAGG - Intergenic
910141501 1:84031693-84031715 TGGATGTCCATCCAAGCAGAAGG - Intergenic
911509486 1:98793650-98793672 TGGAATTGCATCCAATCTGTTGG - Intergenic
913657142 1:120971952-120971974 GGGATTTTCACACTAGCTGATGG + Intergenic
914008485 1:143755036-143755058 GGGATTTTCACTCTAGCTGATGG + Intergenic
914521704 1:148423206-148423228 GGGATTTTCACACTAGCTGATGG + Intergenic
914647115 1:149663687-149663709 GGGATTTTCACTCTAGCTGATGG + Intergenic
915255608 1:154626600-154626622 TGGACTTGCTCCCTTGCTGAAGG - Intronic
915267060 1:154726476-154726498 TCCATCTGCACCCCAGCTGATGG - Intronic
920377023 1:205514303-205514325 GGGATTGGTACCCAAGCAGATGG - Intronic
921325521 1:213983610-213983632 TGGATTTGAACCAAAGATGGTGG + Intronic
923010445 1:230083892-230083914 TGGACCTGCATGCAAGCTGAAGG + Intronic
1064206681 10:13330318-13330340 TGGATTTGCAGGCAATCTGTGGG + Intronic
1069333442 10:67320445-67320467 TAGGCTTGCACCCAAGCTGCTGG - Intronic
1070280727 10:75046352-75046374 TGGCATTGCACTCCAGCTGAGGG + Intronic
1071714615 10:88082897-88082919 TGGATTAGCAGCCCAGCTGAGGG + Intergenic
1075702881 10:124480575-124480597 GTGATTTGCACCCAAGTTAATGG - Intronic
1076169615 10:128308405-128308427 TGCACCTGCACCCAGGCTGATGG + Intergenic
1078530789 11:12135407-12135429 TGGAAGTGAACCCAAGCAGAGGG + Intronic
1083825064 11:65197084-65197106 GGGATTTGAACCCAGGCAGAGGG + Intronic
1084180915 11:67445406-67445428 GGGCTTTGGACCCAAGCCGATGG - Intergenic
1084900246 11:72304404-72304426 GGGATTTGAACCCAAGCAGCTGG + Intronic
1085908162 11:80789848-80789870 TGAAGTTGCAGTCAAGCTGATGG + Intergenic
1086472846 11:87134289-87134311 TGGATTTGAACCCACCCTAAAGG + Intronic
1092844129 12:12568353-12568375 TGGAATTGTCCGCAAGCTGAAGG - Intergenic
1096961455 12:55582216-55582238 TGGATCAGCTCCCAGGCTGATGG + Intergenic
1096973723 12:55686481-55686503 TGGAGTGGCATCCAAGCTGTTGG - Intronic
1100605417 12:96148490-96148512 TGGATTTGAACCCAGATTGATGG - Intergenic
1101237604 12:102805236-102805258 GGGTTCTGCACCCAAGCTTAAGG + Intergenic
1104613413 12:130248988-130249010 TCTATTTGTACCCAAGTTGAAGG - Intergenic
1104711670 12:130991521-130991543 TGGATTTGAACCCAAGCAGATGG - Intronic
1108435654 13:50399062-50399084 TGGAGTTGCAACCCAGCTGTGGG - Intronic
1110369556 13:74724957-74724979 TGGATTTTCTCCCAAGCTTAGGG + Intergenic
1113432315 13:110261678-110261700 GGGATTTGCATCAGAGCTGAGGG + Intronic
1117237032 14:53789078-53789100 TGGATTTGAACCAGAGCTCAGGG - Intergenic
1117573441 14:57073166-57073188 AGGATTTGAACCCAGGTTGATGG + Intergenic
1119114487 14:72006620-72006642 TGAGTTTGCAATCAAGCTGATGG - Intronic
1119198724 14:72737289-72737311 TTGATCTGCACCCAAGAGGATGG - Intronic
1121500075 14:94428283-94428305 TGGATTTGCAAGCAGGGTGAGGG - Intergenic
1122272931 14:100576396-100576418 TGGGGTTGCGCCCAAGCTGGGGG + Intronic
1124701168 15:31913632-31913654 TGGATTTTCAACTAAGCAGAGGG + Intergenic
1126637940 15:50797359-50797381 GGGATTTGAACCCAGGCTGATGG + Intergenic
1130930496 15:88423402-88423424 TGGATTAGGACCCACCCTGATGG - Intergenic
1132492046 16:237381-237403 TGGAGTTGCAGCCAAGATGTTGG + Intronic
1136109905 16:28058183-28058205 TGGATGTGCACCCAGGCGGGAGG - Intronic
1137571561 16:49569469-49569491 AGGATTTGTACCCAAGCCTATGG - Intronic
1140590560 16:76347242-76347264 TGGAACTGTACCCAAACTGAAGG - Intronic
1141911821 16:87065431-87065453 TGCATTTGCTCTGAAGCTGAGGG + Intergenic
1142697210 17:1640183-1640205 TGGATTTGGCCCCAAGTTCAAGG - Intronic
1149238716 17:54623770-54623792 TGGATTTGAACCCAAGCATCTGG + Intergenic
1150428853 17:65100152-65100174 TGGATTTGCCACCTAGCTGTAGG - Intergenic
1152308382 17:79534603-79534625 TGGATTTGCTACCAAGCTTCAGG - Intergenic
1152840639 17:82565803-82565825 TGGATATAGACCCAAACTGAAGG + Intronic
1153049652 18:889738-889760 GTGATTTGCATACAAGCTGAAGG + Intergenic
1154162187 18:11989040-11989062 TGGATTTGCACCCAAGCTGACGG + Intronic
1168144942 19:54415577-54415599 AGGAGATGCACCCAAGCTGAGGG - Exonic
1168230582 19:55028053-55028075 AGGATTTGCACCCAAGCACTAGG - Intronic
1168304593 19:55428684-55428706 TGGATTTCCACCCACGTTTATGG - Intergenic
925670366 2:6304189-6304211 TGGATTAGAACCCACCCTGATGG + Intergenic
925892879 2:8450208-8450230 TTGACTTGCACACAAGCTCAAGG - Intergenic
929787793 2:45004606-45004628 TGGATTTGCAGTGAAACTGAAGG - Intergenic
934761059 2:96857528-96857550 GGGCATTGCACCCAACCTGAGGG - Intronic
935484121 2:103631862-103631884 CGGATTAGCACCCAAGATGGAGG - Intergenic
936143635 2:109963609-109963631 TGAACTTGAACCCAAACTGAAGG + Intergenic
936180319 2:110261572-110261594 TGAACTTGAACCCAAACTGAAGG + Intergenic
936201052 2:110407857-110407879 TGAACTTGAACCCAAACTGAAGG - Intronic
938900859 2:135797461-135797483 GAGATTTGCAGCCAAGCTGTCGG - Intronic
939099020 2:137872967-137872989 TGGATTTGTTTCCAAGATGATGG - Intergenic
940017951 2:149126291-149126313 TGGATTTTCAACCATGCAGAGGG - Intronic
948695307 2:239730161-239730183 TGGATGGGACCCCAAGCTGATGG + Intergenic
1170946568 20:20896209-20896231 TGGATTTACAGCCAAGCCCATGG - Intergenic
1174214957 20:48909325-48909347 TGAATCTGCACCCCAGCTGCTGG - Intergenic
1175878202 20:62240581-62240603 TGGATTTGAACCCAGGCTCCAGG + Intronic
1177278817 21:18951780-18951802 TGGTACTGCACCCGAGCTGAGGG + Intergenic
1177342525 21:19823926-19823948 TCCACTTGCACCAAAGCTGAAGG + Intergenic
1177998206 21:28129380-28129402 TGGATTTGAACCCAACCTTCAGG - Intergenic
1181004284 22:20002940-20002962 TGGATTTGTACCTAATCTGTTGG - Intronic
1182762710 22:32735550-32735572 TGGATTTGCAGGGAAGCTGGGGG - Intronic
1182928519 22:34150756-34150778 TGCATTTCTACCCCAGCTGAAGG - Intergenic
1183782296 22:40006712-40006734 AGGGTCTGCAGCCAAGCTGAGGG + Intronic
951127522 3:19001349-19001371 TGGACTTGACCTCAAGCTGAAGG + Intergenic
951665483 3:25118647-25118669 TGCTTTTTCAGCCAAGCTGAGGG + Intergenic
955141529 3:56274459-56274481 TGGATTTGAACCCATGTTTATGG - Intronic
955941456 3:64150248-64150270 AAGATTTGAACCCAAGCAGATGG - Intronic
960176418 3:114522969-114522991 AATATTTGCACCCAAGCTTATGG - Intronic
965465311 3:169022658-169022680 GGGATTGGTTCCCAAGCTGAGGG + Intergenic
967379876 3:188845775-188845797 TGGATTCACAAACAAGCTGAAGG + Intronic
967802779 3:193682552-193682574 TGCATTGGCACCCAAAATGAGGG - Intronic
968710975 4:2117419-2117441 TGGATTGTCACCCATGGTGAGGG - Intronic
969896328 4:10308384-10308406 TAGGTGAGCACCCAAGCTGATGG + Intergenic
971929968 4:33068866-33068888 TTCATTTGCACCACAGCTGAGGG - Intergenic
972786713 4:42333021-42333043 TGGATTAGGACCCAACCTAATGG - Intergenic
972881104 4:43423925-43423947 TGGAGTTACACCTAATCTGAGGG - Intergenic
978943097 4:114461088-114461110 TGGGTTTGCACACAAGATAAAGG + Intergenic
985422100 4:189794740-189794762 TGGATTTGCACCCAGCCTTGTGG - Intergenic
992880485 5:81104789-81104811 TGGATTGGCACCATAGATGAAGG + Intronic
995783661 5:115804725-115804747 TGGATTTGAACACAATTTGAAGG - Exonic
996334988 5:122373841-122373863 TGGATTTACACCCAAGGGGTGGG - Intronic
996582133 5:125043076-125043098 TGGAAATGGACCCTAGCTGATGG + Intergenic
1001533281 5:172479831-172479853 TGGATTTGAACCCAGACTGTGGG + Intergenic
1003495933 6:6663204-6663226 TGGATTTGGACCCACCCTCATGG + Intergenic
1005227432 6:23658827-23658849 TCCATTTGCACCCAAATTGAGGG - Intergenic
1007655802 6:43450443-43450465 TGTGTGTGTACCCAAGCTGAAGG + Exonic
1012252262 6:96992131-96992153 TGGATTTGCCCCCATCCTGGTGG + Intronic
1013774367 6:113663235-113663257 GGGATTTCCACCCAAGGTGATGG + Intergenic
1013819764 6:114140604-114140626 TGGATTCACAGCCAAGGTGAGGG - Intronic
1015059458 6:128945371-128945393 TGGATTAGCAGGCAAGCTGGTGG - Intronic
1015072863 6:129117872-129117894 AGGATTTGAACCCAGGCTGATGG + Intronic
1015719483 6:136226612-136226634 GGGATTTGAACCCAAGCAGATGG - Intergenic
1028637417 7:93005116-93005138 AGGATTTGGACCCAAGTTGTAGG + Intergenic
1030521877 7:110607408-110607430 TGGAGCTGCACCCATGGTGAGGG - Intergenic
1039952139 8:42180757-42180779 TGGTTTTACAGCCATGCTGATGG - Intronic
1043487280 8:80710440-80710462 TGGATTTCCACCCAGGCAGCTGG + Intronic
1047409965 8:124616265-124616287 TGGATTTGCAGGGAAGCTGCTGG + Intronic
1048510748 8:135060057-135060079 TGTATTTGCACCCCAGCTGGTGG - Intergenic
1049046265 8:140154408-140154430 GAGATTTGCACCCCAGCTGCTGG - Intronic
1051880370 9:21833773-21833795 TGGTGTTGCAAACAAGCTGAGGG - Intronic
1059057388 9:110998354-110998376 TGGACTTTCATCCAAACTGAAGG + Intronic
1059660532 9:116395746-116395768 TGGTTTTGCACCAAATTTGAAGG - Intronic
1060185791 9:121563332-121563354 TGAATTTCCACCCTAGCTGGGGG - Intergenic
1060753952 9:126196349-126196371 TGGACTTGTGTCCAAGCTGAAGG - Intergenic
1061483143 9:130907020-130907042 GGGATTTGAACCCAGGCAGAAGG + Intronic
1062060001 9:134490153-134490175 TGGATTTGAACCCAAGTTGGTGG - Intergenic
1062249267 9:135586144-135586166 GGGATTTGCACACAAGCCCACGG - Intergenic
1187006543 X:15238306-15238328 TGAATTTCCAGCCAGGCTGATGG + Intronic
1188353502 X:29161026-29161048 TCGCTTTGCACCCAGGCTGGAGG - Intronic
1188935079 X:36165888-36165910 TGGATTAGGACCCACCCTGAGGG + Intergenic
1190596395 X:52055682-52055704 TGGAGTTGCACGCAAAATGAGGG + Intergenic
1190612429 X:52198391-52198413 TGGAGTTGCACGCAAAATGAGGG - Intergenic
1197982118 X:132228151-132228173 TGAATTTGCACCCAGTCTTATGG + Intergenic
1199554349 X:149090358-149090380 TGGAATGGCACACAAGTTGAGGG + Intergenic
1200801335 Y:7389632-7389654 TGGAATGGGACCCAAGCTGCTGG + Intergenic