ID: 1154162295

View in Genome Browser
Species Human (GRCh38)
Location 18:11989619-11989641
Sequence CTGTCTCAGAAGAAGGGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 525
Summary {0: 1, 1: 0, 2: 6, 3: 48, 4: 470}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154162283_1154162295 26 Left 1154162283 18:11989570-11989592 CCCTATCTGAGAGGTCCCTATCA 0: 1
1: 0
2: 0
3: 11
4: 87
Right 1154162295 18:11989619-11989641 CTGTCTCAGAAGAAGGGGGAGGG 0: 1
1: 0
2: 6
3: 48
4: 470
1154162288_1154162295 -4 Left 1154162288 18:11989600-11989622 CCCATTTTGCTAACAAAAGCTGT 0: 1
1: 0
2: 1
3: 15
4: 234
Right 1154162295 18:11989619-11989641 CTGTCTCAGAAGAAGGGGGAGGG 0: 1
1: 0
2: 6
3: 48
4: 470
1154162284_1154162295 25 Left 1154162284 18:11989571-11989593 CCTATCTGAGAGGTCCCTATCAT 0: 1
1: 0
2: 1
3: 5
4: 72
Right 1154162295 18:11989619-11989641 CTGTCTCAGAAGAAGGGGGAGGG 0: 1
1: 0
2: 6
3: 48
4: 470
1154162285_1154162295 11 Left 1154162285 18:11989585-11989607 CCCTATCATTTCCTACCCATTTT 0: 1
1: 0
2: 3
3: 26
4: 353
Right 1154162295 18:11989619-11989641 CTGTCTCAGAAGAAGGGGGAGGG 0: 1
1: 0
2: 6
3: 48
4: 470
1154162286_1154162295 10 Left 1154162286 18:11989586-11989608 CCTATCATTTCCTACCCATTTTG 0: 1
1: 1
2: 2
3: 35
4: 373
Right 1154162295 18:11989619-11989641 CTGTCTCAGAAGAAGGGGGAGGG 0: 1
1: 0
2: 6
3: 48
4: 470
1154162289_1154162295 -5 Left 1154162289 18:11989601-11989623 CCATTTTGCTAACAAAAGCTGTC 0: 1
1: 0
2: 2
3: 16
4: 153
Right 1154162295 18:11989619-11989641 CTGTCTCAGAAGAAGGGGGAGGG 0: 1
1: 0
2: 6
3: 48
4: 470
1154162287_1154162295 0 Left 1154162287 18:11989596-11989618 CCTACCCATTTTGCTAACAAAAG 0: 1
1: 0
2: 1
3: 15
4: 174
Right 1154162295 18:11989619-11989641 CTGTCTCAGAAGAAGGGGGAGGG 0: 1
1: 0
2: 6
3: 48
4: 470

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154162295 Original CRISPR CTGTCTCAGAAGAAGGGGGA GGG Intronic
900248095 1:1648774-1648796 CTGTCTCAAAAAAAGGAGAAGGG - Intronic
900259314 1:1715931-1715953 CTGTCTCAAAAAAAGGAGAAGGG - Intronic
901152167 1:7111076-7111098 CTGGCTCTCAAGATGGGGGAAGG - Intronic
901770980 1:11530258-11530280 CGAGCTCAGAGGAAGGGGGAGGG - Intronic
901907028 1:12421825-12421847 CTGTCTCAAAAAAAGGGGGATGG - Intronic
902306762 1:15546307-15546329 CTGTCTCAGAAAAAAGGGTGAGG + Intronic
902367470 1:15986333-15986355 CTGTCTCAAAAGAGAAGGGAAGG - Intergenic
902517613 1:16997834-16997856 CTGTCTCAAAAGAGGAGGGGAGG + Intronic
903396546 1:23006004-23006026 CTGTCTCAAAAAAAGGGAGTTGG + Intergenic
903844180 1:26267556-26267578 CTGTCTCAAAAAAAGGGGGGTGG + Intronic
904302117 1:29561203-29561225 CAATCTCTGGAGAAGGGGGATGG + Intergenic
904696496 1:32334675-32334697 CAGCCTCAGAAGAAGAGGCAGGG - Exonic
905732774 1:40307817-40307839 CTGTCTCAGAGGAACAGGGGTGG - Intronic
906103111 1:43275634-43275656 CTGTCTCAGATGAAAGGAAAGGG - Intergenic
907330069 1:53664939-53664961 CTGTGGCAGGAGGAGGGGGAGGG + Intronic
907868769 1:58424074-58424096 CTGTCTCAGCAGAGAGGTGAAGG + Intronic
908491310 1:64646723-64646745 CTGTCTCAAAAAAAGGTGGGGGG + Intronic
908738882 1:67307512-67307534 CTGTCTCATAAGACGGAGCAAGG - Exonic
908799030 1:67859758-67859780 CTGGCTCTGAAGATGGAGGAAGG + Intergenic
908888146 1:68813693-68813715 CTGACTTTGAAGAAGGAGGAAGG + Intergenic
911601444 1:99852373-99852395 CTGTCTCAGAAAAAGAGAAAAGG - Intronic
911620648 1:100063788-100063810 CTGTCTCCAAAAAAGGGGGTTGG + Intronic
912368812 1:109156947-109156969 TTCTCTCAGAAGAAGGGGGGTGG + Intronic
913168286 1:116209503-116209525 CTGCCCCAGAGAAAGGGGGAAGG - Intergenic
914447460 1:147761803-147761825 ATGTCTGAGAAAAAGAGGGAGGG + Intronic
914918906 1:151834446-151834468 CTTTGTGACAAGAAGGGGGAGGG - Intergenic
914956767 1:152169648-152169670 CTGTCCCAGGAGAAGAGGGAAGG + Intergenic
916744300 1:167672539-167672561 CTGTCTTTGAAGATGGAGGAAGG - Intronic
917884677 1:179371771-179371793 CTGGCTTTGAAGAAGGAGGAAGG + Intronic
918077796 1:181183538-181183560 CTGTGTCCTAAGAAGGAGGATGG + Intergenic
922439313 1:225639539-225639561 CTGTCTCATAACATGGTGGAAGG - Intronic
923639553 1:235740425-235740447 TTGTCTCTGTGGAAGGGGGACGG - Intronic
923920821 1:238562653-238562675 CTGACTCAGAAGAGTGGTGAAGG + Intergenic
924131107 1:240909354-240909376 TTGTTTCAGAAGATGGGGTATGG - Intronic
924955045 1:248917947-248917969 CTGTATCAGGAGAAGGTGGGTGG + Exonic
1062908435 10:1195618-1195640 CTGGTTCAGAAGAATTGGGATGG + Intronic
1062908445 10:1195683-1195705 CTGGTTCAGAAGAAGAGGGATGG + Intronic
1062940518 10:1417462-1417484 CTGACTCAAAAGAAGGATGAAGG + Intronic
1063069472 10:2646587-2646609 CTATCACAGAAGATGGGGGTGGG + Intergenic
1063960827 10:11304244-11304266 CTGGCTCTGAAGATGGAGGAAGG - Intronic
1064561451 10:16598614-16598636 CAGTCTCTGAAGATGGGGAAAGG + Intronic
1065261061 10:23923602-23923624 ATGTGTCGGAAGAAGGAGGAAGG + Intronic
1065620099 10:27572147-27572169 CTGTCTCTAAAAAAGGGGGAGGG - Intergenic
1067793000 10:49301821-49301843 CTGTCTTAGATGAAGGGGAAAGG + Intronic
1069382116 10:67851914-67851936 CTGTCTCAAAAAAAGGAAGAAGG + Intergenic
1071239675 10:83691857-83691879 CTGTCACTGCAGAAGGGGGAGGG - Intergenic
1072463988 10:95646335-95646357 CTGTATCAGGAGAAGAGGGTGGG + Intronic
1072465938 10:95662592-95662614 CTGTCTCAAAAAAAGGGTGGGGG - Intergenic
1072686443 10:97540040-97540062 CCTTCTCTGAGGAAGGGGGAGGG + Intronic
1072711971 10:97721754-97721776 CTGTCTCAAAAAAAAGAGGAAGG - Intergenic
1072753291 10:97999607-97999629 GTTTCTGAGAAGAAGGGGGCAGG + Intronic
1074448027 10:113536541-113536563 CTGTCTCAAAAAAAAAGGGAGGG + Intergenic
1074533924 10:114315273-114315295 CTGTCTCACAAAGAGGAGGATGG + Intronic
1075338966 10:121630259-121630281 CTGTCTCGGAAGAAGGAAGGAGG + Intergenic
1076499609 10:130927090-130927112 CAGTCTCTGAAGAATGGAGATGG + Intergenic
1077030092 11:461633-461655 CAGGCTCAGAAAAAGGGGGAAGG - Intronic
1077505398 11:2927830-2927852 CTATCTCAGAAAGAGGGGCAGGG + Intergenic
1078126926 11:8575037-8575059 CTGTCTCAAAAAAAGGGGGAAGG + Intronic
1078490177 11:11761016-11761038 CTGTCTTGGAAGAAGGAGGAAGG - Intergenic
1080094923 11:28394470-28394492 CTGGCTCACAAGGAGGGGGGTGG + Intergenic
1080313531 11:30922940-30922962 TTGTTTAAGAAGAAGAGGGAAGG + Intronic
1080574561 11:33586345-33586367 TTGTCTCTGAAGAAGGGTAAGGG - Intronic
1081982205 11:47274813-47274835 ATCTCTAAGGAGAAGGGGGAAGG + Exonic
1082011164 11:47450362-47450384 CTGTCTCAAAAAAAAGGGGGGGG - Intergenic
1082045648 11:47724230-47724252 CTGTCTCAAAAAAAGGAGGTGGG - Intronic
1082984977 11:59160744-59160766 CTGGCTTTGAAGATGGGGGAAGG + Intergenic
1084603136 11:70158459-70158481 CTGTATCAGCAGGAGGGGGATGG - Intronic
1084953584 11:72679773-72679795 CTGTCTCAGTTGGAGGAGGAAGG - Intergenic
1085442892 11:76579454-76579476 CAGACTCCGAAGAGGGGGGAAGG + Intergenic
1085577370 11:77618776-77618798 CTGTATCAGAAGAAAAGAGAAGG + Intronic
1086098468 11:83073082-83073104 GTGTCTCAGAAAAGGCGGGAGGG + Intergenic
1087278390 11:96183398-96183420 TTGTCTCAAAAGAAAGGGGGGGG - Intronic
1088326258 11:108604389-108604411 CTGTCTCAAAAGAAAGGCGGGGG + Intergenic
1089258186 11:117205180-117205202 CTAGCTCAGAAGAGGGGAGAAGG + Exonic
1089289302 11:117428359-117428381 AGGTCTCAGAAGCAGGGGGCCGG - Exonic
1089513511 11:119016635-119016657 CTGTCTCAGAAAGGGGGGGGGGG - Intronic
1089749996 11:120644607-120644629 ATGTCTCAGGAGGAGGAGGAAGG + Intronic
1090011381 11:123048608-123048630 CTGTCTCAAAAAAAGAGGGGAGG + Intergenic
1090230411 11:125098868-125098890 CTGGCTCTGAAGATGGAGGAAGG + Intronic
1090391774 11:126393460-126393482 ATGGCTCAGGAGGAGGGGGATGG + Intronic
1090570400 11:128038598-128038620 CTGACTTGGAAGAAGGAGGAGGG - Intergenic
1091493535 12:952886-952908 CTGTCTCAAAAGAAAGGGAACGG + Intronic
1091718191 12:2794741-2794763 GGGTCCCAGGAGAAGGGGGAGGG + Intergenic
1091736014 12:2922688-2922710 CTCTGTCAGAAGAAGAGGGTGGG - Intronic
1091921133 12:4305823-4305845 GTGTCTCAGAAGAGGGGTGCAGG - Intergenic
1092972783 12:13714097-13714119 CTGTCTCTCAGGAAGTGGGAGGG + Intronic
1093105885 12:15086583-15086605 CTGACTTTGAAGAAGGAGGAAGG - Intergenic
1095447774 12:42299723-42299745 CTGTCTGTGAACAAGTGGGAGGG - Intronic
1095521545 12:43072799-43072821 GTGTCTGAGAGGAAGAGGGAAGG - Intergenic
1095548369 12:43400244-43400266 CTGTCTCAGAGGAATGAGAAAGG - Intronic
1096525272 12:52206735-52206757 CTGGCTCCTAAGGAGGGGGATGG - Intergenic
1098254777 12:68606038-68606060 CTGTCTCAAAAAAAGAGGAAAGG + Intergenic
1098498063 12:71159994-71160016 CTGCCTAGGAAGAAAGGGGAGGG - Intronic
1099464441 12:82965772-82965794 CTGGATCAGAACAAGGGGGAGGG - Intronic
1099612479 12:84891831-84891853 CTATGTCAGAAGAATGGGGGCGG - Exonic
1099644969 12:85341436-85341458 CTGCCTTTGAAGAAGGAGGAAGG - Intergenic
1099978541 12:89571649-89571671 CTGACTCAGAGGGAGGGGGAGGG + Intergenic
1100214643 12:92434959-92434981 CTGTCTCTAAAGAAAGAGGAAGG - Intergenic
1100310477 12:93390609-93390631 CTGTCTCAAAAAAAGGGAGGGGG - Intronic
1100627226 12:96347551-96347573 CTGTCTCACAGAAAGGGGAAGGG + Intronic
1101655411 12:106715979-106716001 ATGTCTGAGAAGCAGGTGGATGG + Intronic
1102009598 12:109610093-109610115 CAGTCTCAAAAGAAGGGAGCAGG - Intergenic
1102485062 12:113249930-113249952 CCATTTCAGAAGAAGGGTGATGG - Intronic
1102594357 12:113981213-113981235 CTCCCTCAAAAAAAGGGGGAAGG + Intergenic
1102924222 12:116814583-116814605 CTGGAGCAGAAGAAGGGGCAGGG + Intronic
1103328988 12:120140791-120140813 CTGACTCAGAGGGCGGGGGAGGG - Intronic
1104366079 12:128178742-128178764 CTGTCTCAGAAAAAATGTGAAGG + Intergenic
1104437529 12:128767701-128767723 CAGTCTCAGAATGAGAGGGATGG + Intergenic
1104567982 12:129902724-129902746 GCGGCTCTGAAGAAGGGGGATGG - Intronic
1104688698 12:130807866-130807888 CTGTTTGAGAAGAGGAGGGAGGG - Intronic
1104923353 12:132302794-132302816 CTGTGGCAGCAGAAAGGGGACGG + Intronic
1105492130 13:20899089-20899111 CTGTCTCAAAAGAAAGGGAGGGG + Intronic
1106252795 13:27995600-27995622 CTGTCTCAAAAAAAAGGGGGAGG + Intergenic
1106704603 13:32267204-32267226 ATGGCTGAGAAGAAGGGCGAGGG - Exonic
1107194855 13:37638097-37638119 CTGACCCAGATGTAGGGGGAAGG - Intronic
1107336545 13:39361901-39361923 ATGTCTCAGAAGGAGGGAAAAGG + Intronic
1108125601 13:47239374-47239396 ATGTCTCAGAAAAGGGGAGAAGG + Intergenic
1109349114 13:61154085-61154107 TTGTCTTAGAAGATGGAGGAAGG + Intergenic
1109491373 13:63104865-63104887 CTGGCTCTGAAGATGGTGGAAGG - Intergenic
1109933044 13:69242609-69242631 CTTTCTCAGAAGAGGAGGTAAGG + Intergenic
1110175478 13:72550734-72550756 CTTTCTCATAAAAAGGTGGAGGG - Intergenic
1110427395 13:75383974-75383996 TTATCTCCGAGGAAGGGGGAGGG + Intronic
1110567444 13:76970498-76970520 CTGTCTCAAAAAAAGGAGGTGGG + Intergenic
1113220242 13:108092544-108092566 CTGTATGAGCAGAAGGGGGATGG - Intergenic
1113266065 13:108619643-108619665 CTGGCCAAGAAGAAAGGGGAAGG + Intronic
1113746922 13:112751732-112751754 CTGTCTCAAAAAAAGGGGGGGGG - Intronic
1114441129 14:22748902-22748924 CTGTCAAAGGAGAAGGGGCACGG + Intergenic
1114548089 14:23516997-23517019 CTGTCCAAGAAGAGGGGGAAAGG - Intergenic
1114656695 14:24319991-24320013 CTGTTTAAGAAGAATTGGGAAGG + Intronic
1116760203 14:49003336-49003358 CTGTCTTAGATGAAAGGAGATGG + Intergenic
1117031829 14:51679953-51679975 ATGCCAAAGAAGAAGGGGGAAGG + Intronic
1118256422 14:64209707-64209729 CTGTCTCAGCAGCTGGGGGCAGG - Intronic
1118756045 14:68844357-68844379 CTGTCCCAAAAGAAGAGGGGTGG - Intergenic
1119710289 14:76817259-76817281 TCATCTCAGAGGAAGGGGGAGGG - Intronic
1120513037 14:85438482-85438504 GTGTCTGAGAAGAAGGAGGAGGG + Intergenic
1121571228 14:94947970-94947992 CTGGCTTTGAAGAAGGAGGATGG + Intergenic
1121685328 14:95831397-95831419 CTGTCTCAGGAGAGGACGGAGGG - Intergenic
1121943401 14:98094844-98094866 CTGTCTTAGAATAAGGGGTGAGG + Intergenic
1122221569 14:100241968-100241990 CTGTCTCAAAAGGGGGGGGGGGG + Intronic
1122349967 14:101083437-101083459 CTGGCTTTGAAGATGGGGGAAGG + Intergenic
1122460396 14:101889628-101889650 ATGTCTCAGAGGAAGGGAGCTGG + Intronic
1122742589 14:103880831-103880853 CTGTCTCAGAGGTTGGGGGAAGG - Intergenic
1122860483 14:104580270-104580292 CAGTCCCAGGAGAAGGGGGAAGG - Intronic
1123037678 14:105478099-105478121 GGGTCTCAGAAGGAGGGGCAGGG + Intronic
1123147471 14:106146889-106146911 CTGTCTCAGGAGCAGGGGTGAGG + Intergenic
1202884460 14_KI270722v1_random:91366-91388 CTGTCTCTGTAGAAGTTGGATGG + Intergenic
1123432435 15:20230029-20230051 CTGTCTCAAAAAAAGGGCGGGGG + Intergenic
1123715783 15:23029874-23029896 CCGTCTCAAAAAAAGGGGGTGGG + Intronic
1124009755 15:25829208-25829230 CTGTCTGGGAGAAAGGGGGAAGG + Intronic
1124446086 15:29734273-29734295 TTGGCTCAGAAGAAGAAGGATGG - Exonic
1124870463 15:33536512-33536534 CTGTCCCTGAAGCAGTGGGATGG - Intronic
1124929055 15:34101488-34101510 CTGTCTCAGACTGAAGGGGAGGG - Intronic
1125956853 15:43796425-43796447 CTGTATGAGATGAAGGGGGTGGG - Exonic
1125985499 15:44047300-44047322 CTGTCTCAAAAAAGAGGGGAGGG + Intronic
1128244484 15:66123868-66123890 CTCTCTCAGATGATGGGGCAGGG - Intronic
1128377336 15:67086565-67086587 CTTTCACAGATGAAGGGGGATGG + Intronic
1128545298 15:68562329-68562351 CAGTCTCAGGAGAAGAGGAAGGG - Intergenic
1128647253 15:69386909-69386931 CTGACTCAGGAGAAGGAGTAGGG - Intronic
1129190405 15:73934125-73934147 CTGGCCCACAAGCAGGGGGAAGG - Intronic
1129194450 15:73955757-73955779 CTGGCAGAGAAGAAGGGGCAGGG + Intergenic
1129627989 15:77225322-77225344 CTGTCTCAGAATAATGTGGTTGG - Intronic
1129682713 15:77667046-77667068 CTGGATAAGAAGAAGGAGGAGGG + Intronic
1129709999 15:77816098-77816120 CTGTTTCAGAAGGAGGGGACTGG - Intronic
1129770281 15:78199131-78199153 CTGTCTCAAAAAAAGAAGGAAGG - Intronic
1130161095 15:81401113-81401135 CTGGCTTTGAAGAAGGAGGAAGG - Intergenic
1130258723 15:82337971-82337993 AAGTCACAGAAGAAGGGGGCTGG - Intergenic
1130269962 15:82441113-82441135 AAGTCACAGAAGAAGGGGGCTGG + Intergenic
1130462297 15:84168426-84168448 AAGTCACAGAAGAAGGGGGCTGG + Intergenic
1130490376 15:84426359-84426381 AAGTCACAGAAGAAGGGGGCTGG - Intergenic
1130501967 15:84505117-84505139 AAGTCACAGAAGAAGGGGGCTGG - Intergenic
1130596200 15:85251988-85252010 AAGTCACAGAAGAAGGGGGCTGG + Intergenic
1131365196 15:91833198-91833220 CCCTTTCAGCAGAAGGGGGATGG - Intergenic
1132121484 15:99179727-99179749 CTCTCACAGAAGCAGGTGGAGGG + Intronic
1132141974 15:99404196-99404218 CTGTCTATGAAGAAGGAGCAGGG + Intergenic
1132220500 15:100101618-100101640 GTGTGTCAGAGGATGGGGGAAGG - Intronic
1133293932 16:4740798-4740820 CTGTCTCAGTAGAGGGGTGGAGG + Intronic
1133853578 16:9528653-9528675 CTGTCCCTGAAGTAGGGGAAAGG - Intergenic
1134149310 16:11793526-11793548 CTGTCTCAAAAAAAAGGGGGTGG + Intronic
1134318370 16:13140179-13140201 CTGTCTAAAAAGAAAGGGAAGGG - Intronic
1134432515 16:14224034-14224056 CAGTCACAGTAGAAGGGTGAAGG + Intronic
1134442670 16:14308500-14308522 CTGTCTCAAAAAAAAGGGGACGG - Intergenic
1134644162 16:15853148-15853170 CTGTCTCAAAAAAAAGGTGAGGG - Intronic
1135073577 16:19373699-19373721 CTGGCTCAGAATATGGAGGAGGG + Intergenic
1135284222 16:21179620-21179642 ATGGCTTAGAAGAAGGGGGCTGG + Exonic
1135347923 16:21705146-21705168 CTGTGTGAGAAGAGGAGGGATGG - Intronic
1136560500 16:31036305-31036327 AGGCCTCAGAAGAAGGGGCAAGG + Intronic
1138294448 16:55874304-55874326 CGCTCTCAGCAGAAGGGAGATGG - Intronic
1138979972 16:62256215-62256237 CTGTATGAGAAGAAACGGGAAGG + Intergenic
1139512192 16:67433895-67433917 CTGTTCCAGAAGATGGGGGTTGG + Intronic
1140127688 16:72131848-72131870 CTGTCTCATAAAAAGTGGGGTGG - Intronic
1140148652 16:72338716-72338738 CTGTCTCAAAAGAAACAGGAAGG - Intergenic
1141187867 16:81800935-81800957 CTGGCTCTGAAGATGGAGGAAGG + Intronic
1142107851 16:88315864-88315886 GTGACTCAGCAGGAGGGGGAGGG - Intergenic
1142160376 16:88554507-88554529 CTGGCTCTGAAGATGGAGGAGGG - Intergenic
1142275208 16:89114787-89114809 ATGTCTCAGAGGAAGGCGGGGGG + Intronic
1143055100 17:4156581-4156603 CTGCCTCCTAAGAAGGGGCAGGG + Intronic
1143214163 17:5211707-5211729 CTCTCTAAGAAGAAAGGGGATGG + Intronic
1144070201 17:11664597-11664619 CTGTCCCTGAGGAAGGAGGATGG - Intronic
1144366999 17:14554188-14554210 AGGTCTCAGAAGAAGGAGGTTGG + Intergenic
1145005686 17:19336467-19336489 CTGTGCCAGAAGATGGGGCAGGG - Exonic
1145238733 17:21227088-21227110 CGGAGTCAGAAGAAGGAGGATGG + Intergenic
1145275512 17:21427023-21427045 CTGGTTCAGAGCAAGGGGGATGG - Intergenic
1145711811 17:26984873-26984895 CTGGTTCAGAGCAAGGGGGATGG - Intergenic
1146062922 17:29616391-29616413 CTGTCTAAGACCAAGGGGGTTGG + Intronic
1146090676 17:29874284-29874306 CTGTCTCAAAAAAATGGGGAGGG + Intronic
1146480764 17:33203192-33203214 CTGTCTCAGAAGCAGCCCGAAGG + Intronic
1146822140 17:35992128-35992150 CTGGCTGGGATGAAGGGGGAAGG + Intronic
1147788770 17:42999548-42999570 CAGTCTCAGGAGATGGGAGAGGG - Intronic
1148004420 17:44414310-44414332 CTGTCTCCAAAAAAGGGGGGTGG - Intronic
1148021414 17:44556498-44556520 TTGCCGCAGAAGAAGCGGGAGGG + Intergenic
1148071968 17:44913898-44913920 CTGCCCCAGAAGGAGGGGTAAGG - Intronic
1148396061 17:47309050-47309072 CTGTCTCAAAAAAAGAAGGAAGG - Intronic
1149002664 17:51773414-51773436 CTGTCTGAGAAGCAGAGAGAAGG + Intronic
1149228843 17:54508221-54508243 CAGTCTCAGATGCAGGGGGCAGG + Intergenic
1149802260 17:59580783-59580805 CTGTTTCAAAAGAAGGGGGCTGG + Intronic
1149844231 17:59994706-59994728 CTGTTTCAAAAGAAGGGGGCTGG - Intergenic
1150000505 17:61434130-61434152 ATGTCACAGCTGAAGGGGGATGG + Intergenic
1151859056 17:76745695-76745717 GTGTCTCAGGAGAAGAGGGAGGG - Intronic
1151953702 17:77370000-77370022 CTGTCCCAAGGGAAGGGGGATGG - Intronic
1152011541 17:77721874-77721896 CTGGCTCAGGAGGAGGGGAAGGG + Intergenic
1152044562 17:77927529-77927551 CTTCCTCAAAAGAAGGGGGCTGG + Intergenic
1154162295 18:11989619-11989641 CTGTCTCAGAAGAAGGGGGAGGG + Intronic
1156121539 18:33848603-33848625 CTGGCTTTGAAGATGGGGGAAGG + Intergenic
1157079386 18:44506361-44506383 GTGTGTCAGAAGAAGGGAAAAGG - Intergenic
1157306984 18:46524736-46524758 CTCTCCCTGAAGAAGGAGGATGG - Exonic
1158084836 18:53638898-53638920 CTGTAGCAGAAGAAGTGAGATGG + Intergenic
1158353023 18:56583563-56583585 CTGTCTCAGAAAAAAGGAGGTGG + Intergenic
1159828515 18:73244232-73244254 CTGTCTCTGTTGCAGGGGGAAGG - Intronic
1161524573 19:4745744-4745766 CTGTCTCAAAAAAAGGGGGGTGG - Intergenic
1162085129 19:8244133-8244155 CTGGCTCTGAAGATGGAGGAAGG + Intronic
1162417946 19:10549420-10549442 CTGTCTCAAAAAAAAAGGGATGG - Intronic
1163691803 19:18742452-18742474 CTGTCTCAGAAGCGTGGTGATGG - Intronic
1164505236 19:28854754-28854776 CTGGCTTTGAAGATGGGGGAAGG + Intergenic
1165024343 19:32948728-32948750 CTGTCTCAAAAAAAAGGGGTGGG - Intronic
1165026185 19:32963703-32963725 CTGTCTCAGACAAAGGAGTAAGG + Intronic
1165798374 19:38532549-38532571 CTGCCCCAGAAGAGGGGGGTAGG - Intronic
1166738759 19:45101711-45101733 CTGTCTCAAAAGAAAAAGGAGGG + Intronic
1167582749 19:50356055-50356077 CTGGCTTTGAAGAAGGGAGAAGG - Intronic
1168383382 19:55942992-55943014 CTGCCTTTGAAGAAGGAGGAAGG + Intergenic
1202633613 1_KI270706v1_random:22741-22763 CTGTCTCTGTAGAAGTTGGATGG + Intergenic
1202652273 1_KI270707v1_random:17318-17340 CTGTCTCTGTAGAAGTTGGATGG - Intergenic
1202659868 1_KI270708v1_random:58412-58434 CTGTCTCTGTAGAAGTTGGATGG + Intergenic
925640488 2:5981849-5981871 CTGACTCAGCTGAAGGGGGCTGG + Intergenic
926175974 2:10592480-10592502 ATGTCTCAGGAGAAGGGAGGGGG + Intronic
926190933 2:10727072-10727094 CTGTCTCAAAAAAGGGAGGAAGG - Intronic
927410815 2:22824230-22824252 CAATTTGAGAAGAAGGGGGAAGG + Intergenic
927642650 2:24855195-24855217 CTTCCTAAGAAGAAGGGGGTGGG - Intronic
928041940 2:27887219-27887241 CTGGCTCTGAAGATGGAGGAAGG + Intronic
928082999 2:28326604-28326626 CAGTCTGAGAGGGAGGGGGATGG + Intronic
930643916 2:53883472-53883494 CTGTCTCAGAAAAAAGCGGTGGG + Intronic
931268966 2:60685391-60685413 CTGTCAGGGAAGAAGCGGGAGGG - Intergenic
932280978 2:70491629-70491651 CTGTCTCCGGGGAAGGGGCATGG - Intronic
932775138 2:74524023-74524045 GTGTCCCAGTAGATGGGGGAAGG + Exonic
933076606 2:77935810-77935832 GTGTTTCAGAAGAGGGAGGATGG + Intergenic
933572007 2:84025089-84025111 CTGGCTCTGAAGATGGAGGAAGG + Intergenic
935878756 2:107539919-107539941 CTGTTTCACTAAAAGGGGGATGG + Intergenic
935983848 2:108653338-108653360 CTATCTCAGAAGCCGTGGGAAGG + Intronic
936000164 2:108819633-108819655 ATGTCTCAGAAGAATTTGGATGG + Intronic
936040362 2:109145178-109145200 CTGTCTCAGAAGCAGCAGAAAGG - Intronic
936136281 2:109896992-109897014 CTATCTCAGAAGCCGTGGGAAGG + Intergenic
936208416 2:110474493-110474515 CTATCTCAGAAGCCGTGGGAAGG - Intergenic
936606038 2:113955456-113955478 CTGTCTCAGAGGAAAGGGGTTGG - Intronic
936987030 2:118321353-118321375 CTGTCTCAGGAGTTTGGGGAAGG - Intergenic
937474044 2:122198735-122198757 CTCTCCCAGAAGAATGGAGAAGG - Intergenic
939189234 2:138897014-138897036 CTGTCTCAGAACAGGGGATATGG - Intergenic
940757426 2:157699228-157699250 CTGGGTCAGAAGAAGGAGCAGGG + Intergenic
941204512 2:162554673-162554695 GTGACCCAGAAGAAGAGGGAGGG - Intronic
941891652 2:170588432-170588454 CTGGCTCAAAAAAAGGGAGAGGG + Intronic
941918779 2:170829074-170829096 CTGTATAAGCAGAAGGAGGAGGG - Intronic
941963744 2:171280074-171280096 CTGTACAAGACGAAGGGGGAGGG + Intergenic
942741753 2:179188637-179188659 CTGTCTCAAAAAAAGGGGTGGGG + Intronic
944695785 2:202199275-202199297 CTGTCTCAAAAAAAGGGGGTTGG - Intergenic
944855697 2:203764792-203764814 CTGACTCAGAAGAACTGAGAGGG - Intergenic
947385545 2:229586990-229587012 CTGACTCAGACGAAGTGAGATGG - Intronic
947538197 2:230954221-230954243 CTGTGTCAGGGGAAGGGGCAAGG - Intronic
947695889 2:232188133-232188155 CTGTCTCAAAAAAAAGTGGAGGG + Intronic
947813624 2:233021599-233021621 CTGTCTCAGAACTGGGGAGAGGG + Intergenic
1170129583 20:13004562-13004584 CTGACTTTGAAGATGGGGGAAGG + Intergenic
1170218478 20:13916799-13916821 CTGTCTCAAAAAAAGGTGGCGGG + Intronic
1170331339 20:15214038-15214060 CTGTCAGAAAAGAAGGGGGTGGG - Intronic
1170553740 20:17499070-17499092 CTCTTAGAGAAGAAGGGGGATGG - Intronic
1171507168 20:25646931-25646953 CTTTCTCAGTTGAAGGGGAAAGG + Intergenic
1171988302 20:31676093-31676115 CTGGCTCAGAACCAGGGTGATGG + Intronic
1172076085 20:32298683-32298705 CTGTCTCTGAAGAAGGGAAGGGG - Intronic
1172583584 20:36066530-36066552 CTGTACCAGAATAAGGGGGAAGG + Intergenic
1173544684 20:43886007-43886029 CTGACTCAGAACAATGGGGAGGG + Intergenic
1173570326 20:44071641-44071663 CTGCCTCCCAAGAAGGAGGAAGG - Intergenic
1174883295 20:54304247-54304269 CTGTCTCAAAAAAAGGTGGATGG - Intergenic
1176046467 20:63095362-63095384 CTGGCTCTGAAGACGGAGGATGG + Intergenic
1176599878 21:8782337-8782359 CTGTCTCTGTAGAAGTTGGATGG + Intergenic
1176645827 21:9348598-9348620 CTGTCTCTGTAGAAGTTGGATGG + Intergenic
1177245053 21:18512424-18512446 CTGTCTCTGAAGAAGTTGCAAGG - Intergenic
1178534778 21:33402959-33402981 CCGTCTCAAAAAAAAGGGGAGGG + Exonic
1178780983 21:35603337-35603359 CTGTCTCAGAGGTTGGGAGAAGG + Intronic
1179452741 21:41476711-41476733 ATGTCTCAGAAGACAGGAGAGGG - Intronic
1180327343 22:11441974-11441996 CTGTCTCTGTAGAAGTTGGATGG + Intergenic
1180367101 22:11950555-11950577 CTGTCTCTGTAGAAGTTGGATGG - Intergenic
1180974360 22:19839120-19839142 ATGGATCAGAAGGAGGGGGAGGG + Intronic
1181179742 22:21058507-21058529 CTGTCTCAAAAAAAAAGGGAAGG + Intronic
1182901373 22:33901041-33901063 CTGTCTCAGAAAAAAAGGGAGGG + Intronic
1183812826 22:40272222-40272244 CTGTCTGTGCACAAGGGGGAGGG - Intronic
1184197055 22:42936904-42936926 CTGCCTCAAAAAAAGGGGGGGGG + Intronic
1185103060 22:48851986-48852008 CTGTCTCAGCAGAGCAGGGAAGG - Intergenic
1185201263 22:49506987-49507009 CTGTCTCATAAAAAGGAAGAAGG + Intronic
951051249 3:18096577-18096599 CTGTCTTTGAAGAGGGAGGAAGG - Intronic
951312782 3:21149439-21149461 CTGTGTCATAACATGGGGGAAGG - Intergenic
951652596 3:24967475-24967497 CTGTCAGAGATGAAGAGGGAAGG - Intergenic
951884647 3:27512201-27512223 CTGATTCATTAGAAGGGGGAAGG - Intergenic
951986571 3:28628018-28628040 CTTTCTCAGAAGAGGAGGTAAGG - Intergenic
952258070 3:31712530-31712552 CTGGCTCTGAAGATGGAGGAAGG + Intronic
952441585 3:33335843-33335865 CTGTCTCAGAAGAAGCGGGCAGG + Intronic
953202463 3:40789709-40789731 CTGACTTTGAAGAAGGGGAAAGG + Intergenic
953543162 3:43840610-43840632 CTGGCTCAGGAGAAGGGCTAAGG + Intergenic
954139655 3:48598348-48598370 CTGCCTCAGGAAAATGGGGAGGG + Intergenic
954366055 3:50146793-50146815 CTGTCTCAGGAGAGTGGGGGAGG + Intergenic
955113875 3:55976980-55977002 CTGTGTGAGAACAAGGTGGAAGG - Intronic
956619007 3:71201620-71201642 CTGTCTCGAAAAAAGGGGGCGGG + Intronic
957773941 3:84730781-84730803 CTGTGTGAGAAGAAAGAGGAAGG - Intergenic
961075355 3:123977049-123977071 TTCCCTCAGAAGAAGGTGGAAGG - Intronic
961308333 3:125975473-125975495 TTCCCTCAGAAGAAGGGGGAAGG + Intronic
961424275 3:126832762-126832784 CTGACCCAGAGAAAGGGGGAGGG + Intronic
961658261 3:128454946-128454968 CTGGCTTTGAAGATGGGGGAAGG + Intergenic
961843061 3:129734743-129734765 TTGTCTCTGAAGAAGCGGAATGG + Intronic
962872909 3:139513649-139513671 CTGTCTCAGTAGCAAGGAGAGGG - Intergenic
963252315 3:143114775-143114797 CTGTCTCAGAAAAAAGGAGGAGG - Intergenic
963729313 3:148956232-148956254 CTGTCCCCAAAGAAGGGTGAAGG - Intergenic
964620595 3:158716997-158717019 GTGACTCAGAGGAAGGGAGAAGG - Intronic
964653772 3:159043551-159043573 CTGTCTCAAAAAAAGCGGGGCGG - Intronic
966804758 3:183798356-183798378 CTGTCTCAAAAGAAAAGGAAAGG - Intronic
968075825 3:195815767-195815789 CTGTGTAAGAAGAAGGAGGCCGG - Intergenic
968099754 3:195956721-195956743 CTGAATCAGAAGATCGGGGATGG + Intergenic
1202741058 3_GL000221v1_random:56465-56487 CTGTCTCTGTAGAAGTTGGATGG - Intergenic
968591435 4:1461670-1461692 CTGTCTGGGAAGCACGGGGAAGG - Intergenic
968677565 4:1892327-1892349 CACTCTCAGAAGCAGGGGGAAGG - Intronic
968810545 4:2797784-2797806 CTGTCCCAGAGGAAGGGTGAGGG + Intronic
970010574 4:11454576-11454598 GTGTATCAGAAGAAGGAGGCTGG + Intergenic
970947527 4:21712616-21712638 CTGTCTCAGGAGAAAGGTGTGGG - Intronic
970997675 4:22286111-22286133 CTGGCTCTGAAGATGGAGGAAGG - Intergenic
972804054 4:42509362-42509384 CTGTTGAGGAAGAAGGGGGATGG + Intronic
972912931 4:43841177-43841199 CTGGCTTAGAGGAAGGGGAAGGG - Intergenic
974408195 4:61503995-61504017 CTGTCTTACAAAAAGGGGGTTGG - Intronic
974940269 4:68459856-68459878 CTGTTACAGAAGAAAGGAGATGG - Intronic
975678037 4:76847211-76847233 CTGTCTCAGCTGATGAGGGAAGG + Intergenic
976151715 4:82099154-82099176 CTCTCCAAGAAGAAGGTGGAGGG - Intergenic
976221798 4:82762165-82762187 CTGTCTCAAAAGAAGAGGAGAGG + Intronic
976396818 4:84564864-84564886 CTGTCTCAAAAAAAAGGGGGGGG + Intergenic
978560467 4:110028615-110028637 CGGTCTCAAAAGCAGGGGGGAGG - Intergenic
978845813 4:113271372-113271394 CTGTCCCAGAAGAAGGGTGCAGG + Intronic
981125401 4:141100312-141100334 CTGTCTCAGAAGAACAGGTAAGG + Intronic
981358651 4:143821965-143821987 CTGTCTCAAAAAAAGAAGGATGG - Intergenic
982538311 4:156635266-156635288 CAGACTCACAAGATGGGGGAGGG - Intronic
983501641 4:168506242-168506264 CTGTTGTAGAAAAAGGGGGAAGG - Intronic
983588192 4:169378699-169378721 CTGTCTCAAAAAAAGGTGGGGGG - Intergenic
983650079 4:170028348-170028370 CTGTCTAAGGAGGAGGAGGATGG + Intronic
984106029 4:175547074-175547096 GTGTCACAGGAGAAGAGGGAAGG + Intergenic
984541075 4:181037615-181037637 CCCTCTCAGAAGAAAGGAGAAGG - Intergenic
984902284 4:184596015-184596037 CTGTCTCAAAAGAAAAGGGGAGG + Intergenic
986536142 5:8789272-8789294 GTGTCTCAGAACATGGGGCAAGG - Intergenic
987229859 5:15882534-15882556 CTGTGTAAGAAGAATGGGGAAGG - Intronic
987248116 5:16070345-16070367 CCGTCCCAGAAGAAGTGTGAGGG - Intronic
988550697 5:32198291-32198313 TTGTCTCAGTAAAAGGGGAAAGG + Intergenic
988787146 5:34575552-34575574 CTGTCAAAGAAGAGGGGTGATGG - Intergenic
989079841 5:37606941-37606963 CTGTCAAAAAAGAAAGGGGATGG - Intronic
990708654 5:58558374-58558396 CTTGATCAGAAGAAGGAGGAAGG - Intergenic
991354911 5:65758229-65758251 CTGTCTTAAAAAAAGAGGGAGGG + Intronic
992029091 5:72702843-72702865 CTGTCTCAAAAAAAAGGGAAGGG + Intergenic
992042388 5:72848595-72848617 CGGTCTCGGAGGATGGGGGAGGG - Intronic
992256569 5:74927349-74927371 CTCCCTCAGAAGAGGGGGCATGG + Intergenic
992832606 5:80609033-80609055 CTTGCTCACAAGAAGGGAGAGGG + Intergenic
994207200 5:97048365-97048387 CTGTCTTGGAAGATGGAGGAAGG + Intergenic
995567988 5:113451712-113451734 CTGTCTCAAAAAAAGAAGGAAGG + Intronic
996351825 5:122552211-122552233 CTGTCTTTGAAGATGGAGGAAGG + Intergenic
998411898 5:141917564-141917586 CTGTGTCAGAAGAAAAGGGATGG + Intergenic
998514828 5:142743456-142743478 CTGTCACAGAATAAGGGTCAAGG + Intergenic
998968645 5:147567595-147567617 CTGTCTCAAAAAAAAGGGGGGGG + Intergenic
999125337 5:149242068-149242090 CTGTCTTTGAGGGAGGGGGAGGG + Intronic
999498038 5:152119442-152119464 CTGTGTCAGGAGCAGGTGGAGGG + Intergenic
999831298 5:155322650-155322672 CTCCCACAGAAGAAGGGGAAGGG - Intergenic
1000070105 5:157732441-157732463 CTGTCTCAGAAAAAGAGGGAGGG + Intronic
1000472566 5:161663752-161663774 CTGTCTGTGAAGAAGAGTGAAGG + Intronic
1001584948 5:172827536-172827558 CTGTCTCATAACATGGTGGAGGG - Intergenic
1001710030 5:173771180-173771202 GTCTCACAGGAGAAGGGGGAGGG - Intergenic
1002113994 5:176943113-176943135 ATGCCTCAGGAGAAGGGGAAGGG - Intronic
1002198543 5:177514059-177514081 CTGACCCAGGAGAAGGGGGAAGG - Intronic
1002293933 5:178218299-178218321 CTGTCCCAGAAGGAGAGGAAAGG + Intronic
1002351763 5:178588947-178588969 CTATCCCAGGAGAAGGAGGAAGG + Intronic
1002773836 6:311857-311879 CTGTCAGAGAAGAAAGGGGATGG - Intronic
1003133135 6:3412826-3412848 CTGGCTCTGAAGACGGAGGATGG + Intronic
1003644519 6:7903749-7903771 CTGTTTCTGAAGGAGGTGGAGGG - Intronic
1004759260 6:18648039-18648061 CTGTCTTAGAAGACAAGGGAGGG + Intergenic
1005127984 6:22470730-22470752 ATGTCCCAGAAGCAGGAGGAAGG + Intergenic
1005728060 6:28669105-28669127 CTGTCTTTGAAGATGGAGGAAGG + Intergenic
1006177259 6:32129913-32129935 GGGTCTCAGAAGAATGGGAAAGG - Intronic
1006884819 6:37372596-37372618 CTGTCTCAGGAGAGGGTGCAGGG - Intronic
1008025085 6:46627070-46627092 CGGTGGCAGAAGAAGGGGGTGGG + Intronic
1009440149 6:63668340-63668362 CTGTCTCAAAAAAAAGGGGGAGG - Intronic
1009962544 6:70541246-70541268 CACTCTCAGAAAAAGGGGAAAGG - Intronic
1010046230 6:71447304-71447326 CTGTCTGGGGAGAAGGGGCAGGG + Intergenic
1010233722 6:73557803-73557825 CTGTCTCAAAAAAAAGGGGTCGG - Intergenic
1010237320 6:73586044-73586066 CTGCCTCAGAAGAAGAGACATGG - Intergenic
1010572697 6:77496914-77496936 CTGTCTCTGAAGATGGAGAAAGG - Intergenic
1011202926 6:84857316-84857338 CAGACTTAGAAGATGGGGGAGGG - Intergenic
1011413202 6:87087072-87087094 CTGTCTCAAAAGAAAAGGCAAGG + Intronic
1011507963 6:88068402-88068424 CTCTCCCAGAAGGAGGGGGCAGG - Intergenic
1011805052 6:91062208-91062230 AAGTCTCAGAGGAAGGGGCAGGG + Intergenic
1015627488 6:135195731-135195753 CTGTGTCTAAGGAAGGGGGAAGG - Exonic
1015816086 6:137212260-137212282 CTGTCTCAAAAGGAGGGGAGTGG - Intronic
1015935307 6:138402661-138402683 CTGCCTCAGAAGAAGAGGCAGGG - Intergenic
1015958247 6:138620837-138620859 CTGGCTCAGAGGATGTGGGAGGG - Intronic
1016925960 6:149348382-149348404 CTGTCTCAGAAAGAGAGAGAAGG + Intronic
1017724033 6:157264460-157264482 CTGTCTCAAAAAAGGGGGGGCGG + Intergenic
1018750341 6:166798765-166798787 CTGTCTGTGGAGAAGGGGGCAGG - Intronic
1019684234 7:2371754-2371776 CTGTTTAAAAAAAAGGGGGAAGG - Intronic
1019841217 7:3447507-3447529 CTGTCCTAGAAGAATGGGGTGGG - Intronic
1019873660 7:3790218-3790240 CTGTCTCTGAAGAAATGGAATGG + Intronic
1019896410 7:3986903-3986925 CTGTCACATAAATAGGGGGAGGG - Intronic
1020003746 7:4770631-4770653 CTGTTTCAGGAAAAGGGGGGCGG + Exonic
1020036345 7:4965547-4965569 CTGTCTCAAAAAAATGGGTAGGG - Intergenic
1020825361 7:13020746-13020768 TTCTCCCAGAAGAAGGGGAACGG - Intergenic
1022900036 7:34798528-34798550 CTGTCTAAGAAAAAGGGGCGGGG + Intronic
1023458685 7:40369594-40369616 CTGGCCCCTAAGAAGGGGGAGGG + Intronic
1023655509 7:42415749-42415771 ATGTCTCTAAAAAAGGGGGAGGG - Intergenic
1023951183 7:44847678-44847700 CCGTCTTAGAAGGAGGAGGACGG - Intronic
1024057921 7:45677479-45677501 CTCTCTTAGAAGGAGGGGGTTGG + Intronic
1024387810 7:48773613-48773635 CTGTCACAGGAGAAAGAGGATGG - Intergenic
1024522197 7:50315226-50315248 CAGTCTCAGACAAAGGGAGACGG + Intronic
1024638665 7:51311347-51311369 CTGGCTCAGAAGCACAGGGATGG + Intronic
1024915191 7:54491559-54491581 CTGTCTCAGTATAACAGGGATGG + Intergenic
1026347164 7:69483920-69483942 CTGTCTCAAAAAAAAGGGGGGGG + Intergenic
1026793831 7:73353030-73353052 CTGTCTTTGAAGAAGAGGAAGGG - Intronic
1026912640 7:74100230-74100252 CTGTCTCAAAAAAATGGGGCAGG + Intronic
1026919426 7:74144377-74144399 CTGTCTCAAAGAAAGGGGAAGGG - Intergenic
1028506621 7:91578655-91578677 CTGTGTCAGATGAAGCTGGAGGG - Intergenic
1028953585 7:96664430-96664452 CTGTCTTTGAAGATGGAGGAGGG - Intronic
1029330303 7:99848005-99848027 CTGTCTCAAAAAAAAGGGGCAGG + Intronic
1029375300 7:100173859-100173881 CTGTCTCAGCAGCAGGGGACTGG - Exonic
1029918877 7:104240833-104240855 CTCTCTCAGAAAACGGGTGAGGG - Intergenic
1030059446 7:105611200-105611222 CAGTCCCAGAGGAAGGGGAAGGG - Intronic
1030930106 7:115512334-115512356 GTGTCTCAGAAAAATGGGGGAGG - Intergenic
1031174332 7:118330411-118330433 CTGTCTCTGGTGAAGGGGCAGGG + Intergenic
1032534813 7:132653968-132653990 CTGCCTGAGAAGATGGTGGAAGG + Intronic
1032822247 7:135534779-135534801 CTGTCTCAAAAGAAGATGGGAGG + Intergenic
1033118140 7:138644592-138644614 CTGTCTGAGAGGCAGGGCGATGG - Intronic
1033192265 7:139292246-139292268 CTGTCTCAAAAAAAAGGGGGCGG + Intronic
1033213782 7:139479838-139479860 CTGCCTCAAATGAAGGGGCATGG + Intronic
1033656060 7:143375439-143375461 CTGTCTCAGAAAAAGGGAACAGG - Intergenic
1033790306 7:144785117-144785139 CTGTCCCAGGGGAATGGGGAAGG + Intronic
1034256786 7:149729116-149729138 CTGCCACAGAAGAAGGGACAGGG - Intronic
1034421297 7:150992458-150992480 CTGTCTCAGGAGGAGGGAGATGG - Intronic
1036699238 8:11000976-11000998 CTGAATCAGAGGAAGGGGGCAGG - Intronic
1036796868 8:11762522-11762544 CTGTGTCAGAGGGAGGGAGAGGG - Exonic
1036803366 8:11809095-11809117 CTTTCAGAGAAGAGGGGGGAGGG + Intronic
1037624324 8:20594113-20594135 CTCTCTCGGCAGAAGGGAGAGGG + Intergenic
1037822126 8:22140084-22140106 CTGTCACAGCACAAGGGGCAGGG + Intronic
1037889701 8:22617408-22617430 CTGCCTCTGTAGAAGGAGGATGG + Exonic
1038438911 8:27558262-27558284 CTGTCCCTGAGGAAGGGGCAGGG - Intergenic
1038616923 8:29104012-29104034 CTGTCTCCGAAGCATGTGGATGG + Intronic
1038652572 8:29419160-29419182 CTGCCTCAAAACAAGGGGGGGGG - Intergenic
1038740561 8:30213135-30213157 CTGTCTCAGAGGGAGGAGCAGGG + Intergenic
1039453137 8:37691646-37691668 CTGTGTCTGAAGCCGGGGGATGG + Intergenic
1041342010 8:56856103-56856125 CTGGCTCTGAAGATGGAGGAAGG - Intergenic
1041567274 8:59293115-59293137 CAGGCCAAGAAGAAGGGGGAAGG + Intergenic
1042151039 8:65784200-65784222 CTGTCTCAAAAAAAGGGGCGAGG + Intronic
1042810771 8:72823040-72823062 CTGGCTCCTAAGAAGGAGGAAGG + Intronic
1044618640 8:94167384-94167406 CTGTGTCAGCTGATGGGGGAGGG - Intronic
1044974224 8:97647522-97647544 CTGTCTAAAAAAAGGGGGGAAGG + Intronic
1045061949 8:98418528-98418550 CTTTCACAGCAGAAGGGCGAGGG + Intronic
1045318660 8:101064761-101064783 CTCACTTAGAAGAAGGGGTATGG + Intergenic
1045375868 8:101573705-101573727 CTCCGTCAGAAGCAGGGGGAGGG + Exonic
1045425159 8:102058911-102058933 CTGTCTTTGAAGATGGAGGAGGG + Intronic
1046507478 8:115154704-115154726 CTGTCCCAAAGGAAGGGGGCAGG - Intergenic
1046903498 8:119547109-119547131 CTGTCTTCCAAGAAGGAGGAAGG - Intergenic
1047584149 8:126251167-126251189 CTGTCTCAGAAAAAAGGAGGGGG - Intergenic
1048986676 8:139738534-139738556 CTGGCTATGAAGACGGGGGAAGG + Intronic
1049414178 8:142487894-142487916 CTCCCTCTGTAGAAGGGGGATGG - Intronic
1049478011 8:142805846-142805868 CTGTCTTGGGAAAAGGGGGATGG + Intergenic
1049805555 8:144537214-144537236 CAGCCCCAGAAGCAGGGGGAGGG - Intronic
1050168575 9:2791955-2791977 CAGTCCCTGAATAAGGGGGAGGG + Intronic
1051319269 9:15883031-15883053 CTGTCTCAAAAGAAAAGGAAGGG - Intronic
1051715299 9:19976480-19976502 CAGTCACAGTAGAAGGTGGAGGG - Intergenic
1052155256 9:25179500-25179522 CTTTCACAGCAGAAGGGAGAGGG + Intergenic
1052399910 9:27987321-27987343 CTGTCTCAGGAAAGGAGGGAAGG - Intronic
1052829309 9:33202175-33202197 CAGTTTCAGTAGAAGGGGCAGGG + Intergenic
1053440157 9:38109385-38109407 CTGTCTCAAAAAAAAGGGGGGGG - Intergenic
1054766153 9:69044353-69044375 ATGTCTCTGAAGAAGTGAGAGGG - Intronic
1055809160 9:80131541-80131563 CTGTCTCAGAAGAAAGGGGGTGG + Intergenic
1057135940 9:92687994-92688016 CTGTCTCAAAAAAAGGAGGAGGG - Intergenic
1057205447 9:93169329-93169351 TGATCCCAGAAGAAGGGGGAAGG - Intergenic
1057214854 9:93222171-93222193 CTGCCTCAAAAAAAGGGGGTGGG - Intronic
1057247081 9:93465828-93465850 CTGCCCCAGAAGACAGGGGATGG - Intronic
1057477963 9:95420676-95420698 CTGTGACAGAAGGAGAGGGAGGG - Intergenic
1057913562 9:99038497-99038519 CTGTTTTATAAGAAGGGGGAGGG + Intronic
1058549656 9:106100628-106100650 CTGTCGAAGAAGCAGGGAGAGGG - Intergenic
1059314541 9:113412764-113412786 CTCTCTCTCAAGTAGGGGGAGGG - Intronic
1059486320 9:114629736-114629758 CTGACTCAGAAAGAGGGGGCAGG + Intronic
1060871049 9:127040395-127040417 CTGTCTCAGAAGAAAAGAAAAGG + Intronic
1061352777 9:130078871-130078893 GGGTCTCATGAGAAGGGGGAAGG + Intronic
1061417328 9:130454205-130454227 CTGTCTCTGTAGCAGGGGGTGGG + Intronic
1061510574 9:131058564-131058586 CTGTCTGAGAAGAAGGCTGCTGG + Intronic
1061529825 9:131201921-131201943 CTTTCTCAGAAGACTGTGGAAGG - Intronic
1061885293 9:133588190-133588212 CGGTCTCAGCAGAAAGGGGCTGG - Intergenic
1062301484 9:135874466-135874488 CTGTCTCAAAAAAGGGGGGGGGG + Intronic
1062492975 9:136816710-136816732 CTGTCTCAAAAAAAAGGGGGGGG + Intronic
1203709697 Un_KI270742v1:86395-86417 CTGTCTCTGTAGAAGTTGGATGG - Intergenic
1185774400 X:2790794-2790816 CTGTCTCAAAAAAAGGCGGGGGG + Intronic
1186129203 X:6448203-6448225 CTGGCTTTGAAGAAGGAGGAAGG - Intergenic
1186652560 X:11576941-11576963 CTGGCTTTGAAGAAGGAGGAAGG - Intronic
1186683468 X:11900199-11900221 TTTTGTCTGAAGAAGGGGGAAGG + Intergenic
1187257167 X:17654154-17654176 CCATCTCAGAAACAGGGGGATGG - Intronic
1187996295 X:24930649-24930671 CTGTCTCAGAAGCAGGCCGTGGG + Intronic
1188178691 X:27026377-27026399 CTGTCTCAAAAAAAGGGGGTGGG - Intergenic
1189097672 X:38157435-38157457 CTGTCTTTGAAGATGGAGGAAGG - Intronic
1189219625 X:39360203-39360225 ATCTCTCAGATGAAGGGAGAGGG + Intergenic
1189234923 X:39479411-39479433 CTGTCTGAGAACGAGGGAGATGG - Intergenic
1189357640 X:40323551-40323573 TTGTCTTAGAAGAAGGGGCCAGG - Intergenic
1189481339 X:41394445-41394467 CAGGCACAGAAGAAGGAGGAGGG + Intergenic
1189556204 X:42147921-42147943 CTGTCTCACTAGATGTGGGATGG + Intergenic
1191857989 X:65643063-65643085 CTGACTCAGAAGAAGGGAAGAGG - Intronic
1191951821 X:66601203-66601225 CTGCCTCAGAAGAAGAGAGATGG - Intronic
1192574834 X:72235301-72235323 CTGGCTCGGTAGATGGGGGAAGG - Intronic
1193112917 X:77747515-77747537 CTGTCTCAAAAAAAGGGGGCGGG + Intronic
1198323239 X:135540759-135540781 CTGTCTCAAAAAAAAGGGGGTGG - Intronic
1199737469 X:150696984-150697006 CTTTATCAGAAGAAGGGGGAAGG + Intronic
1199923208 X:152431790-152431812 CTGACTTTGAAGATGGGGGAAGG + Intronic
1201382686 Y:13401186-13401208 CTGTGTCAGAACATGGTGGAAGG - Intronic