ID: 1154162630

View in Genome Browser
Species Human (GRCh38)
Location 18:11991305-11991327
Sequence AATAGCCACGAGACTAAAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 1, 3: 3, 4: 68}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154162621_1154162630 27 Left 1154162621 18:11991255-11991277 CCAGTGCCTTGTCAGGGCGGAGG 0: 1
1: 0
2: 1
3: 6
4: 111
Right 1154162630 18:11991305-11991327 AATAGCCACGAGACTAAAGGAGG 0: 1
1: 0
2: 1
3: 3
4: 68
1154162624_1154162630 21 Left 1154162624 18:11991261-11991283 CCTTGTCAGGGCGGAGGGCGACT 0: 1
1: 0
2: 1
3: 2
4: 54
Right 1154162630 18:11991305-11991327 AATAGCCACGAGACTAAAGGAGG 0: 1
1: 0
2: 1
3: 3
4: 68

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154162630 Original CRISPR AATAGCCACGAGACTAAAGG AGG Intronic
900581944 1:3413779-3413801 AAGAGCCACCAGGCCAAAGGAGG + Intronic
904010785 1:27389034-27389056 GAGAGCCAAGAGACTAAAGGGGG - Intergenic
907840696 1:58154612-58154634 AAGTACCAGGAGACTAAAGGAGG + Intronic
912321113 1:108714556-108714578 ATTAGCCAGGAAACTATAGGAGG + Intronic
916571451 1:166031355-166031377 ATTAGTCACAAGACTAAGGGAGG - Intergenic
918247919 1:182676246-182676268 AAAAGCCACGAGAGTGGAGGAGG + Intronic
1069529853 10:69209120-69209142 GATAGCCACAATACTAGAGGAGG - Intergenic
1077683504 11:4269298-4269320 AATAGCCAAGAAAAAAAAGGGGG + Intergenic
1077691690 11:4348653-4348675 AATAGCCAAGAAAAAAAAGGGGG - Intergenic
1083662098 11:64256191-64256213 AGTAGTCAGGAGAGTAAAGGGGG + Intronic
1083957746 11:65995149-65995171 AATAGACATGAGTGTAAAGGAGG + Intergenic
1088866586 11:113853500-113853522 AATATCTACGAGAGTATAGGAGG - Intronic
1088924893 11:114291804-114291826 AATGGCTAAGAGAGTAAAGGTGG - Intronic
1091113069 11:132988760-132988782 ATTAGTCCAGAGACTAAAGGAGG - Intronic
1091562707 12:1627239-1627261 AATAGCCACGAGCCTAGGTGGGG - Intronic
1093752677 12:22818814-22818836 AATTGCAATGATACTAAAGGAGG + Intergenic
1095219483 12:39592708-39592730 AAAAGCCACTGGAATAAAGGAGG - Intronic
1100921570 12:99494244-99494266 AATAGACACCTGACTAAAGTGGG + Intronic
1110710961 13:78650369-78650391 TATAGTCAAGATACTAAAGGTGG + Intronic
1121418948 14:93798890-93798912 AATAGCAAGGAGTCTAGAGGAGG - Intergenic
1127403681 15:58618073-58618095 AATAGCCAAAAGAATAAAGCTGG + Intronic
1141708474 16:85683231-85683253 AATTGCCAGGAGACAAAAAGGGG - Intronic
1144844477 17:18209317-18209339 AAAAGCCAGGAGACTAAAGGGGG - Exonic
1146511729 17:33455353-33455375 AATAGACACGGGACTACTGGAGG - Intronic
1149070770 17:52539646-52539668 AATAGCCTCTACACCAAAGGTGG - Intergenic
1149202567 17:54204226-54204248 AATAGACACTAGAATAAGGGTGG - Intergenic
1152409460 17:80115711-80115733 AATAGCAACGAGACCTGAGGGGG - Intergenic
1154162630 18:11991305-11991327 AATAGCCACGAGACTAAAGGAGG + Intronic
1156607834 18:38689269-38689291 AAAAACCACAACACTAAAGGTGG + Intergenic
1157007384 18:43599982-43600004 AATAGCTTTGAGAATAAAGGAGG + Intergenic
1158760474 18:60379905-60379927 AACAGCCTTGAGACTGAAGGAGG + Intergenic
928519568 2:32075522-32075544 AAAAGCCATGACACTAAATGAGG - Intronic
930099007 2:47588748-47588770 AATAGCCACAACAGTTAAGGGGG + Intergenic
931908815 2:66871754-66871776 AAAATCCAGGAGAATAAAGGAGG + Intergenic
935738552 2:106126406-106126428 AATCGCCACTACACTAGAGGGGG + Intronic
940755180 2:157673836-157673858 AATTGCCACTAGACTGAATGCGG + Intergenic
940789672 2:158018872-158018894 AGGAGCCAAGAAACTAAAGGAGG + Intronic
1173334929 20:42104782-42104804 CATAGCCACAACACTAAATGTGG - Intronic
1175611158 20:60352365-60352387 AGTGGCCACCAGAATAAAGGGGG + Intergenic
949394063 3:3596119-3596141 CATAGCCACAAGGCTAAAGGGGG + Intergenic
951743730 3:25953482-25953504 AATAGTCACAAGAAAAAAGGTGG - Intergenic
953014491 3:39060237-39060259 AATTGCCAGGAGATTGAAGGAGG - Intronic
979296811 4:119042239-119042261 AAAAGACAAAAGACTAAAGGGGG + Intronic
985079550 4:186250644-186250666 AATAGCCATGAGAAAAAAGAAGG + Intronic
987876055 5:23682295-23682317 AAAAGCCAAGTGACTAAAGTAGG + Intergenic
987975127 5:25005551-25005573 ATTAGCCATCAGACTGAAGGGGG - Intergenic
988523070 5:31963602-31963624 AATTGCCCCAAGACTCAAGGTGG - Intronic
991724451 5:69522236-69522258 AATACCAACGAAACTACAGGAGG - Intronic
998263137 5:140646390-140646412 AAAAGCCAGTAGACTACAGGAGG - Intronic
999538667 5:152547903-152547925 AATAGCCAGGAGAATAATGATGG - Intergenic
999889978 5:155967035-155967057 AATATGCACGACAATAAAGGAGG - Intronic
1003007001 6:2391622-2391644 AATAGCCCTGAGACCAAATGAGG - Intergenic
1010581380 6:77600962-77600984 TATAGCCATGAGACTAAATAAGG - Intergenic
1011354122 6:86456099-86456121 AATAGGGACCAGACTGAAGGTGG - Intergenic
1012748304 6:103123111-103123133 AACAGCCATGAGACTTAATGAGG - Intergenic
1015551025 6:134412598-134412620 AATAGCCACTATACTGAAGAGGG - Intergenic
1015575762 6:134669284-134669306 AATAGCCACAGGAATAAAGTGGG + Intergenic
1026399306 7:69993235-69993257 AATAGCCACATAACCAAAGGAGG - Intronic
1026607694 7:71829673-71829695 AATAGCCTCTAGAGTAAAGTGGG + Intronic
1028487921 7:91380225-91380247 AATAGCCAGGAGACTGAAGAGGG - Intergenic
1031407821 7:121406982-121407004 AATAGACACTAGACTCAAGCAGG - Intergenic
1037211674 8:16395999-16396021 AATAGTCACAACACTAAATGGGG - Intronic
1039067521 8:33621860-33621882 AATAGCCATGTGGATAAAGGTGG + Intergenic
1043861361 8:85320849-85320871 AATAGGGACGAGAATGAAGGGGG + Intergenic
1044400076 8:91760115-91760137 AACAGCCAAGAGGCTAAATGTGG - Intergenic
1047747445 8:127855467-127855489 CAAAGCCACCTGACTAAAGGAGG - Intergenic
1048607081 8:135980277-135980299 AAAAGCAACAAGACTGAAGGAGG + Intergenic
1055112381 9:72572540-72572562 CATAGACATGGGACTAAAGGAGG + Intronic
1057523009 9:95775085-95775107 AATAGCAAAGAGACTCAATGTGG + Intergenic
1186752753 X:12638626-12638648 AATAGCCAGGGAACAAAAGGTGG - Intronic
1189108099 X:38256984-38257006 AAAAGCCAGGAGACTACATGTGG - Intronic
1197856803 X:130921776-130921798 AATAGCCAAGAAAATTAAGGAGG - Intergenic
1202016446 Y:20411758-20411780 AATAGCCACAAGAAGAAAGAAGG + Intergenic