ID: 1154164285

View in Genome Browser
Species Human (GRCh38)
Location 18:12002836-12002858
Sequence TGCAGTGGGGTTTTTCATAG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 148}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154164285 Original CRISPR TGCAGTGGGGTTTTTCATAG CGG (reversed) Intronic
900713167 1:4127872-4127894 TTCAGTGTGGGTTTTCGTAGTGG + Intergenic
904413493 1:30340308-30340330 TGCAGTGGGATTTTGCAGTGTGG + Intergenic
907011273 1:50965762-50965784 TTCAGTGGTTTTTTTCATATAGG - Intronic
908405488 1:63810358-63810380 TGCATTGGGGAATTACATAGCGG + Intronic
912208785 1:107535974-107535996 TGCTGTGGGGTGCTGCATAGTGG - Intergenic
919254212 1:195099970-195099992 TTCAGTGTGGTTTTTTTTAGTGG + Intergenic
919585519 1:199434279-199434301 TGCATTGTGATTTTTGATAGAGG - Intergenic
922162049 1:223085192-223085214 TGCAGTGGGGTCTTGCAGTGGGG + Intergenic
922984692 1:229857296-229857318 TCCATTGGGGTTTTTAATGGAGG - Intergenic
923329414 1:232908963-232908985 CGAAGTGGGGGATTTCATAGTGG - Intergenic
924815131 1:247434860-247434882 TGCTGTGCTGTTTTCCATAGTGG - Intronic
1063251316 10:4278425-4278447 AGCAGTGGGATTTTTCACTGGGG + Intergenic
1063946595 10:11182186-11182208 TGCAGTGTGGTTCTTCACACTGG - Intronic
1064407470 10:15077006-15077028 TTCCGTGCTGTTTTTCATAGAGG - Intergenic
1066814476 10:39387566-39387588 TGCAAAGGGGTTTTTCTGAGCGG - Intergenic
1070538492 10:77398278-77398300 TTCTGTGCTGTTTTTCATAGAGG + Intronic
1072530248 10:96312230-96312252 TACAGTGGTGTTTCTCAAAGTGG + Intronic
1073771891 10:106743763-106743785 TGCAGTCAGATTTTTCACAGCGG - Intronic
1082634876 11:55583594-55583616 TGCAGTGGGGTCCTCCACAGAGG - Intergenic
1084787589 11:71452549-71452571 TGCAGTTTGGTATTCCATAGTGG - Intronic
1085635096 11:78152812-78152834 TGCAGACGGGTTTTGCATTGTGG - Intergenic
1086114591 11:83234739-83234761 TAAAGTGGGGTTTTTAATAGAGG + Intronic
1089155302 11:116397471-116397493 TGCAGATGCTTTTTTCATAGAGG + Intergenic
1093073921 12:14737164-14737186 TGCAGTGGGGTCTTGCAGTGTGG + Intergenic
1095884874 12:47178147-47178169 TGGTGTGGGGTTTTGTATAGAGG - Intronic
1099166886 12:79317811-79317833 TGCTGTGGGTTTTTCCTTAGGGG + Intronic
1099175584 12:79418003-79418025 TGCAGGAGAGTTTTTCACAGAGG - Intronic
1100933298 12:99635176-99635198 TGCAGTGCTGTTTTCCATAGTGG - Intronic
1102107972 12:110342154-110342176 TTCAGTGGGCTTTTGCCTAGGGG + Intronic
1102811258 12:115825983-115826005 TGTAAGTGGGTTTTTCATAGAGG - Intergenic
1105288610 13:19029925-19029947 TTTTGTGGGGTTTTTTATAGAGG - Intergenic
1107260484 13:38484722-38484744 TGCTGTGCTGTTTTTCATACTGG + Intergenic
1107272232 13:38633475-38633497 TGCAGTGGGGTTTATGATAGTGG + Intergenic
1107312873 13:39098583-39098605 TGCAATGGTGTTTAACATAGTGG - Intergenic
1108447145 13:50520859-50520881 AGCAGTAGGGTTTTCCCTAGTGG + Intronic
1108477881 13:50839360-50839382 TGCAGTGAGTTTCTTCATGGTGG - Intronic
1109089073 13:58016106-58016128 TGCAATGGGGTTTTGCAATGTGG - Intergenic
1109263460 13:60170046-60170068 TGCAATGGGGTTTTGCAGGGCGG + Intergenic
1110126125 13:71944090-71944112 TGCAGTGGTTTGTTTCACAGAGG + Intergenic
1114196331 14:20480051-20480073 TGCAGTGGGCTTTATGATTGCGG + Intergenic
1115401230 14:32963067-32963089 TCCAGTGGCTTTTCTCATAGTGG + Intronic
1121945873 14:98121337-98121359 TGCAGTGGGGTTTTCCAGTGAGG - Intergenic
1122087634 14:99318553-99318575 TGCAGTTGAGTTATTCACAGAGG - Intergenic
1122667110 14:103338205-103338227 TGCTGTGTGGTTTTTCTGAGGGG + Intronic
1123995733 15:25716574-25716596 TGCGGTGGGGTGCTTCATACTGG - Intronic
1129485518 15:75867531-75867553 TTCAGTGGGGTTTTGAAAAGAGG + Intronic
1129612005 15:77068320-77068342 TTCAGTGGTGCTTTTCATAGCGG - Intronic
1130265593 15:82399424-82399446 TTCAGTGGGGTTTTAGAAAGAGG + Intergenic
1130506419 15:84547466-84547488 TTCAGTGGGGTTTTAGAAAGAGG - Intergenic
1131431280 15:92391234-92391256 TGAAGTGGGATTTTTCTTGGAGG - Intergenic
1132335679 15:101046909-101046931 TACAGTGGTGTTTTTCAAAGTGG + Intronic
1134017497 16:10899243-10899265 TGAAGTGTGGTGTCTCATAGTGG - Intronic
1134028460 16:10972821-10972843 AGCAGAGGGCTTTTTCATTGTGG + Intronic
1135285036 16:21186055-21186077 TGCAGTGAGGTTATTCATTCAGG + Intergenic
1137528351 16:49258456-49258478 TTCAGTGACATTTTTCATAGAGG + Intergenic
1137732126 16:50696989-50697011 CCCAGTGGGGTTTTTCAGTGAGG + Intronic
1140624588 16:76776657-76776679 TTCAGTGGGGATTTTCATACTGG - Intergenic
1142389535 16:89789858-89789880 TGAACTGGGGGTTTTCACAGGGG + Intronic
1146374663 17:32285962-32285984 TGCTGTGGGGTTTTTAGGAGTGG + Intronic
1148064260 17:44857252-44857274 GGCAGTTGGGGTTTTCACAGAGG - Intronic
1150724869 17:67643500-67643522 AACAGTTGGGCTTTTCATAGAGG + Intronic
1154164285 18:12002836-12002858 TGCAGTGGGGTTTTTCATAGCGG - Intronic
1155940277 18:31795670-31795692 TGCAGTGGTGTCTTTCAGAAAGG + Intergenic
1156772893 18:40750797-40750819 TACAGTGGGATTTTTCGAAGTGG + Intergenic
1157852934 18:51074562-51074584 TGTAGTGGGGATGTTGATAGTGG + Intronic
1157972216 18:52283727-52283749 CGCAGTGGGGTCTTCCACAGTGG + Intergenic
1158416848 18:57256520-57256542 TGCAGTGAGGATTCTCTTAGGGG - Intergenic
1163563979 19:18038690-18038712 TGCAGTGGGCATTGTCAGAGCGG + Intergenic
1163787874 19:19285910-19285932 TGCAGTTGGGTTTATGATCGGGG + Intronic
1164097319 19:22023145-22023167 TGTAGTGGGGTTTTTCCTCAAGG + Intergenic
1165274912 19:34740812-34740834 TGCAGTGGGGCTTTCTCTAGAGG - Exonic
933348446 2:81121470-81121492 TCCAAAGGGGTTTTTCAAAGTGG + Intergenic
935028043 2:99296276-99296298 CGCATTGGGGTTTTACAGAGGGG - Intronic
935310366 2:101777291-101777313 TGCAGTGCCTGTTTTCATAGCGG + Intronic
935736308 2:106109177-106109199 TGCAGTGGGATTTTTCGGGGGGG - Intronic
941754649 2:169172081-169172103 TGCAGTGGTGATTTTTACAGCGG + Exonic
942144597 2:173014312-173014334 TTCTGTGGGGTTTTTCATGAGGG + Intronic
945293785 2:208150604-208150626 TGCAATGGGGTTTTGCAGTGGGG + Intergenic
946586349 2:221192055-221192077 TGTAGTGGGGATGTTGATAGTGG + Intergenic
947393386 2:229663019-229663041 CCCAGTGTGGTTTTTCTTAGAGG - Intronic
1169395615 20:5226335-5226357 TGGAGTGGGGTTGGTCATAATGG + Intergenic
1172184504 20:33022976-33022998 TGCAGTGGAGTGTAGCATAGGGG + Intronic
1173178581 20:40784151-40784173 TGTAGAAGGGTTTTACATAGAGG - Intergenic
1179595842 21:42442706-42442728 TGCAGTGGGGTTTTGCAGCAGGG + Intronic
1181786253 22:25229459-25229481 TGAAGTTGGGGTTTTCATAGAGG - Exonic
1181818423 22:25457282-25457304 TGAAGTTGGGGTTTTCATAGAGG - Intergenic
956853682 3:73255453-73255475 TGCAGTTGGGGTTGTCACAGTGG + Intergenic
960864759 3:122188080-122188102 TGCTGGAGGGTTTTACATAGAGG + Intronic
960993709 3:123327818-123327840 TGCAGTTTGGTTTTTCACGGGGG - Intronic
961948354 3:130718472-130718494 TGCCGTGGGATTTATCACAGTGG - Exonic
963060489 3:141221113-141221135 TGCAATGGGGTTTTGCAGTGGGG - Intergenic
963112809 3:141700931-141700953 TCCAGTGGGGTCCTTCACAGAGG + Intergenic
966483001 3:180432393-180432415 TAGACTGGGGTTTTTCACAGAGG + Intergenic
968858900 4:3150732-3150754 TGCAGTCCGGTTTTTAACAGAGG - Intronic
969170081 4:5355243-5355265 AGCAGTGGGCATTTTCACAGTGG - Intronic
969370753 4:6729742-6729764 TGCAGTGGTGTTTGTAACAGAGG + Intergenic
972117233 4:35651650-35651672 TCTATTGGGGTTTTTCACAGTGG - Intergenic
974250314 4:59376534-59376556 TACAGTGGGGTTTTTAGAAGCGG + Intergenic
974416723 4:61617558-61617580 TGCAGAGGTGTTTTTCTTACAGG - Intronic
975398255 4:73903083-73903105 GGCAGTGTGATTTTTCAGAGGGG - Intergenic
976752302 4:88461778-88461800 AGCGCTGGGGTTTTTCATAGAGG + Intronic
980022343 4:127724470-127724492 TGCATTGGGTTTTTTCAAAGGGG + Exonic
980298884 4:130962193-130962215 TACAGTAATGTTTTTCATAGTGG - Intergenic
982858840 4:160421653-160421675 TTCTGTGGGTTTTTTCATATAGG + Intergenic
984135844 4:175937402-175937424 TTCAGTAAGTTTTTTCATAGAGG - Intronic
984593891 4:181645610-181645632 TGCAGTGTGGTTTTTTTGAGAGG - Intergenic
987227066 5:15853275-15853297 TGAAGTGGGGTTTGAGATAGAGG + Intronic
987276545 5:16369240-16369262 TGCAGTGGGATGTTTTCTAGTGG - Intergenic
988890583 5:35612463-35612485 TGCAGTGGGGTTTTACAATAGGG + Intergenic
990852352 5:60220984-60221006 TGCAGTGGAGTTGTTCATAAAGG - Intronic
991069511 5:62461129-62461151 TGCAGTGGGGTTTTGCAGTAGGG + Intronic
991139774 5:63226714-63226736 TGCAATGGGGTTTTGCATTGGGG + Intergenic
996795612 5:127343395-127343417 TACAGTGGGGTCTATCATGGAGG - Intronic
997500581 5:134370670-134370692 TGCAGTGGGGTTTCTAGTATTGG - Intronic
999016332 5:148110296-148110318 TCCAGTGGGGTGTTCCATACTGG + Intronic
999446434 5:151643980-151644002 TGCCATGCTGTTTTTCATAGTGG + Intergenic
1001133031 5:169080027-169080049 TGCAACGGGGGTTTGCATAGGGG + Intronic
1001867289 5:175116629-175116651 TGCAGTGGGTTAGTTAATAGAGG - Intergenic
1003439425 6:6125325-6125347 AGCAGTGGGATTTGTCATAGGGG + Intergenic
1008157607 6:48035927-48035949 TGCAATGGGATTTTTCAGTGGGG - Intronic
1008953367 6:57185949-57185971 TGCAATGGAGTTTTTAATGGAGG + Exonic
1011627901 6:89298328-89298350 GGCAGCTGGGTTTTTCAGAGGGG + Intronic
1011934021 6:92753083-92753105 TGCAGTTGGGTTTTACGTGGTGG + Intergenic
1014079407 6:117270358-117270380 TGCAGCGGCGTTTTTCTAAGGGG - Intronic
1016292320 6:142538954-142538976 TCCAGTGGGGTCTTTCTCAGAGG - Intergenic
1016927405 6:149364846-149364868 TTCAGTGCAGTTTATCATAGTGG - Intronic
1019804401 7:3112772-3112794 GGCACTGGGGTTTTTCTTTGAGG - Intergenic
1023015089 7:35959674-35959696 AGCTGTGGTGTTTTCCATAGTGG + Intergenic
1025579427 7:62692857-62692879 CGCAGTGCGGTTTCTCAGAGAGG - Intergenic
1027914808 7:84303068-84303090 TGCAATGAAGTTTTTCAAAGAGG + Intronic
1027978564 7:85187431-85187453 TGGATTGAGGTTTTACATAGTGG - Intergenic
1028054688 7:86226732-86226754 TGCAGTTGGCATCTTCATAGTGG + Intergenic
1028198618 7:87934911-87934933 GGCGGTGGGGATTTTCGTAGGGG + Intronic
1029354872 7:100044294-100044316 TGCAGTGGGGTCTTGCAGTGAGG - Intergenic
1030277257 7:107734631-107734653 TGTAGTGGGGTCTTTCATCAAGG - Intergenic
1030354042 7:108523621-108523643 CGCAGTGGATTTTTTCTTAGGGG - Intronic
1030673212 7:112359926-112359948 TGCTGTTGGGATTTTGATAGGGG - Intergenic
1031228675 7:119075511-119075533 GACATTGGGGTTTTTCATAAGGG - Intergenic
1031305722 7:120124279-120124301 AGCAGTGGTCTTTTTCATATTGG + Intergenic
1031317952 7:120280969-120280991 AGCACTGGGGTTTATCATAATGG + Intronic
1032654450 7:133912395-133912417 TACATTGGGGTTTTTCAAAGAGG + Intronic
1036508144 8:9375011-9375033 TTCAGTAGGGTTTTCCACAGAGG + Intergenic
1038572552 8:28675447-28675469 TGCAGTGGACTTTTCCTTAGGGG - Intronic
1041592279 8:59602226-59602248 TGCAATGGTGTTTTAGATAGAGG - Intergenic
1042191085 8:66187809-66187831 TGAAGTTGGGCTTTTCATAAGGG + Intergenic
1043368483 8:79563015-79563037 TGCAGTGTGGTATCTCATTGTGG - Intergenic
1044741324 8:95329543-95329565 TGCAGTTGGCTTTTTCTTATTGG - Intergenic
1044824270 8:96181416-96181438 CACACTGGGGTTTCTCATAGTGG + Intergenic
1049292228 8:141810290-141810312 CTCAGTGGGGTTTTCCAGAGTGG + Intergenic
1051209095 9:14722614-14722636 TGCCGTGTGGTCTTTCCTAGAGG + Exonic
1052151899 9:25127407-25127429 TACACTGGGGTCTTTCAGAGTGG + Intergenic
1052261170 9:26517946-26517968 TGCAGTGGGGCTATTCATAAAGG - Intergenic
1053680929 9:40484701-40484723 TGCAGTGGGGATTTGCAAATAGG - Intergenic
1053930917 9:43113015-43113037 TGCAGTGGGGATTTGCAAATAGG - Intergenic
1054282784 9:63140234-63140256 TGCAGTGGGGATTTGCAAATAGG + Intergenic
1054294011 9:63320216-63320238 TGCAGTGGGGATTTGCAAATAGG - Intergenic
1054392036 9:64624705-64624727 TGCAGTGGGGATTTGCAAATAGG - Intergenic
1054503693 9:65891623-65891645 TGCAGTGGGGATTTGCAAATAGG + Intronic
1054995405 9:71382242-71382264 AGCAGTTGAGTTTTTCATAGAGG - Intronic
1055999383 9:82198166-82198188 TGCAGTAGGGTTTTGCAGTGTGG + Intergenic
1059347378 9:113638516-113638538 TGCAGTGGGTTTTTTTTTTGTGG + Intergenic
1059530164 9:115028208-115028230 TGCAGTGGATTTTTCCTTAGGGG - Intronic
1060865560 9:126992998-126993020 AGCAGTAGGTTTTTTCATAGAGG + Intronic
1060869691 9:127029716-127029738 TGCCGTGGGGGTCTTCAGAGAGG + Intronic
1187827462 X:23346315-23346337 TGCAGTGGGGTTTTGCAGTAGGG + Intronic
1193957088 X:87876747-87876769 TGTAGTGGGGTCTTTCATCAAGG - Intergenic
1199265369 X:145821301-145821323 TGCAGAGGGGTTTCTCAAGGAGG - Exonic