ID: 1154164556

View in Genome Browser
Species Human (GRCh38)
Location 18:12004818-12004840
Sequence TAGAATCCACAATATAGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 217}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154164556_1154164561 6 Left 1154164556 18:12004818-12004840 CCCTGCCTATATTGTGGATTCTA 0: 1
1: 0
2: 1
3: 9
4: 217
Right 1154164561 18:12004847-12004869 TGTTCCAGTGGCTTTTAGGAAGG 0: 1
1: 0
2: 0
3: 10
4: 173
1154164556_1154164559 -6 Left 1154164556 18:12004818-12004840 CCCTGCCTATATTGTGGATTCTA 0: 1
1: 0
2: 1
3: 9
4: 217
Right 1154164559 18:12004835-12004857 ATTCTATGTAGATGTTCCAGTGG 0: 1
1: 0
2: 0
3: 15
4: 154
1154164556_1154164560 2 Left 1154164556 18:12004818-12004840 CCCTGCCTATATTGTGGATTCTA 0: 1
1: 0
2: 1
3: 9
4: 217
Right 1154164560 18:12004843-12004865 TAGATGTTCCAGTGGCTTTTAGG 0: 1
1: 0
2: 0
3: 13
4: 182

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154164556 Original CRISPR TAGAATCCACAATATAGGCA GGG (reversed) Intronic
904639398 1:31912557-31912579 GAGCATTCACAGTATAGGCAGGG + Intronic
905682584 1:39884741-39884763 TACAATCCGCAAAATAGGAAAGG + Intergenic
905970526 1:42138389-42138411 TAAAATCTCCAATATAGGCCAGG - Intergenic
910050772 1:82971621-82971643 TAGAATAAATAATATTGGCAAGG + Intergenic
910223072 1:84908524-84908546 TACCATCCAGGATATAGGCATGG + Intergenic
910874742 1:91867859-91867881 TATAAGACAGAATATAGGCATGG + Intronic
911811890 1:102293605-102293627 TACAATTCAGGATATAGGCATGG - Intergenic
912184035 1:107252923-107252945 CAGATGCCACAAAATAGGCATGG + Intronic
915987016 1:160476379-160476401 TACCATTCACAACATAGGCATGG - Intergenic
916097075 1:161360809-161360831 TAGAATAGAAAATATAGGCTGGG + Intronic
917022861 1:170609305-170609327 TACCATTCACAACATAGGCATGG - Intergenic
917583698 1:176403563-176403585 TATAATTCAGGATATAGGCATGG - Intergenic
917955632 1:180094679-180094701 TAAAATGTACTATATAGGCAAGG - Intronic
920903185 1:210132807-210132829 TAGAATCCAGAAGAGAGGCTAGG - Intronic
922399133 1:225233860-225233882 TACCATTCAGAATATAGGCACGG - Intronic
922900454 1:229132556-229132578 TAGAATCTAAAATATAGGTCAGG + Intergenic
923364070 1:233242402-233242424 TATAACTCACAAAATAGGCATGG - Intronic
923950933 1:238953120-238953142 AAAAATCAACAATATAGGCTGGG + Intergenic
924144431 1:241059428-241059450 TGGAATCCACACTCTAGGAATGG + Intronic
1064437595 10:15324810-15324832 TAGAAACCACAACTTAGTCACGG + Intronic
1065851572 10:29794473-29794495 TAGAAACCATAAAATAGGCCAGG + Intergenic
1066066931 10:31768714-31768736 TAGAATACATAATATAGTCTGGG - Intergenic
1066943864 10:41897988-41898010 TAGAATCTACAAAATTGGAATGG + Intergenic
1067236717 10:44457269-44457291 TAGAATCCACAGTATCTGCCAGG - Intergenic
1068062784 10:52090106-52090128 TAGAAACAACAATCTAGGCCGGG - Intronic
1070696797 10:78569818-78569840 AAGAATCCACAAGATAGGCCTGG - Intergenic
1071689817 10:87805216-87805238 TAGAATACACATTAAAGGCAAGG - Intronic
1071733920 10:88276951-88276973 TAGGATCCAGAATTTATGCAAGG - Intronic
1071796249 10:89009446-89009468 TGGAATGCACATTATAGGCAGGG + Intronic
1074898041 10:117793938-117793960 GAGAGTCAACAAGATAGGCATGG + Intergenic
1078487540 11:11737973-11737995 TAGAAACCAACATATAGGAAAGG - Intergenic
1078635559 11:13046545-13046567 TAGGATCCAGAATGTAGGGAGGG - Intergenic
1080475621 11:32588093-32588115 TAGAAACCACATCATAGGCCAGG + Intronic
1083155100 11:60817895-60817917 TATAATCCACATTTTCGGCAAGG - Intergenic
1086155219 11:83657833-83657855 AAGAATAGACAATATAGGCTGGG - Intronic
1088394635 11:109352892-109352914 TAGAATCCACATTATGTCCAAGG + Intergenic
1088725079 11:112627501-112627523 TAGAATCCACAAGAGATGGAAGG + Intergenic
1089374346 11:117983924-117983946 TACAAACTACAATACAGGCAGGG + Intergenic
1091269554 11:134297563-134297585 TAGAATTTAAAATATAGGCCGGG + Intronic
1093829810 12:23741975-23741997 TAGAACTCACAAGATAGACAAGG + Intronic
1094438310 12:30446299-30446321 TAGAAACCACAATAAAAACAAGG + Intergenic
1094478513 12:30861213-30861235 TAGTATACACAATATAGAAAAGG - Intergenic
1095579733 12:43783614-43783636 TATAATACACAAGATAGGCTGGG - Intronic
1097714047 12:62946272-62946294 TAAAAACCACAATATTGGCCAGG - Intergenic
1097893703 12:64803572-64803594 TACAATTCAGAACATAGGCATGG - Intronic
1098926644 12:76358475-76358497 TAAAAACCACACTCTAGGCAGGG - Intronic
1099540253 12:83899469-83899491 TACAATTCAGGATATAGGCATGG - Intergenic
1100462288 12:94812233-94812255 TAGAATCAACTATTTAGGAACGG + Intergenic
1101571109 12:105954542-105954564 CAAAATCCACAATAGAGGCATGG - Intergenic
1103438066 12:120942277-120942299 TAGAATCAACCATAAAGGGAAGG - Intergenic
1103629322 12:122246895-122246917 TAAAATCCACAGTATAGGGCAGG - Intronic
1106976791 13:35227812-35227834 TAGAATACACAATGTATGTAGGG + Intronic
1107158873 13:37201924-37201946 TAGAAATAACAATATATGCAAGG - Intergenic
1107456635 13:40561671-40561693 TAGAATATAGAATATAGGCCAGG + Intronic
1107631849 13:42350815-42350837 CAGAAACCAAGATATAGGCAGGG - Intergenic
1107739754 13:43437256-43437278 TAGAATAAACAAAATACGCATGG + Intronic
1107906198 13:45063370-45063392 GAGAATTCTCAATATAGGCTAGG - Intergenic
1108498812 13:51050136-51050158 TAGAAAGCACTGTATAGGCATGG - Intergenic
1110328522 13:74244702-74244724 TAGAATCCAAAAAATATGAAGGG - Intergenic
1113573787 13:111380480-111380502 TAGAAACCACCATCTGGGCATGG + Intergenic
1116304307 14:43230922-43230944 TACAACTCAGAATATAGGCATGG - Intergenic
1117613302 14:57506200-57506222 TAGAATCCATAATATGTGCTGGG + Intergenic
1118150653 14:63186004-63186026 TATATACCACAATATAGTCAAGG + Intergenic
1118814677 14:69301685-69301707 TAGAATCAAGAATCTAGGGAAGG + Intronic
1119242548 14:73073227-73073249 TTGAATCCAAAATAAAGACAAGG - Intronic
1122335033 14:100968407-100968429 TGGAATGGATAATATAGGCATGG + Intergenic
1125114338 15:36071792-36071814 TAGAAACCAAAATCTGGGCATGG - Intergenic
1125862451 15:43011929-43011951 TAGAATCTACATTATAGGCCGGG + Intronic
1126161491 15:45617696-45617718 TAAAATCGAAAATATAGGCCGGG + Intronic
1126285232 15:47002654-47002676 TACCATCCAGGATATAGGCATGG - Intergenic
1128144470 15:65325080-65325102 TAGAAACCACAAAATGGGCCAGG - Intergenic
1132663637 16:1072281-1072303 TAGGATCCACAAATAAGGCATGG + Intergenic
1134626701 16:15727494-15727516 TAGAATCCAAAATATCAGCTGGG - Intronic
1135868317 16:26125569-26125591 TAGAATCCTCAAGAAAAGCATGG + Intronic
1137428130 16:48397129-48397151 TAGCAGCTACAATATAGTCATGG + Intronic
1138283254 16:55788414-55788436 AAGAATCCACATTATTGGCTGGG - Intergenic
1139786053 16:69393052-69393074 AAAAATCCACAATTTAGGCCGGG + Intronic
1142936544 17:3338345-3338367 TAGCATTCAAGATATAGGCATGG - Intergenic
1145011604 17:19371543-19371565 TAGAAGCCACCATAGAGGTAAGG - Intronic
1145103227 17:20094021-20094043 TAAAATATACAATATAGGCTGGG - Intronic
1145701039 17:26830405-26830427 TAGAATCGAAAGAATAGGCATGG + Intergenic
1145871550 17:28277601-28277623 TAGAAACAACAATATAGGCTAGG + Intergenic
1146308952 17:31752289-31752311 TAAAATGCACAAAATAGGCCTGG - Intergenic
1147530634 17:41273738-41273760 TAAAATCCAAAATATATGGATGG + Intergenic
1203164138 17_GL000205v2_random:78503-78525 CACAATACACAATATATGCAGGG + Intergenic
1153142267 18:1986660-1986682 TATGATTCAGAATATAGGCATGG + Intergenic
1154164556 18:12004818-12004840 TAGAATCCACAATATAGGCAGGG - Intronic
1154416925 18:14181008-14181030 TATAATAAACAATATAGGCTGGG - Intergenic
1155603026 18:27571177-27571199 TAAAATCCACAACTTGGGCATGG + Intergenic
1158710455 18:59832532-59832554 TAGAGTTCAATATATAGGCAAGG + Intergenic
1161885534 19:6991842-6991864 TGAAATACACAATATAGGCCGGG + Intergenic
1163226381 19:15964257-15964279 TAGAATCCAGAGTCCAGGCAGGG - Intergenic
1164119924 19:22256891-22256913 CACAATACACAATGTAGGCAGGG + Intergenic
1165619672 19:37234976-37234998 TAGAAACCACAATCTAGGCTGGG + Intronic
925337699 2:3109762-3109784 GAGAATCCAAAATACAGGCCAGG + Intergenic
930529783 2:52574066-52574088 TAGAATTCAGAATATTGGTAAGG - Intergenic
931067782 2:58606101-58606123 TAGAATCCTCTTTAGAGGCAAGG - Intergenic
932116935 2:69059804-69059826 CAGAACCCACAATATATCCAAGG + Intronic
933633821 2:84685054-84685076 CAGACTTCACAATATAAGCAAGG - Intronic
934720409 2:96571321-96571343 AAGAATCCACAATTTAGGCAAGG - Intergenic
936116001 2:109703722-109703744 TAAAATACAGAAAATAGGCAGGG - Intergenic
936821472 2:116527360-116527382 TAGAAGCCACAGAAGAGGCATGG - Intergenic
937192954 2:120122249-120122271 TACCATTCAGAATATAGGCATGG - Intronic
940968874 2:159872178-159872200 GAAAATCTAGAATATAGGCAAGG - Intronic
940999484 2:160186038-160186060 TACAATTCAGAACATAGGCATGG + Intronic
941217677 2:162734105-162734127 TAGAATCCACAATTTAATAATGG - Intronic
942179750 2:173369258-173369280 GAGAATCAACAAAAAAGGCATGG + Intergenic
943699332 2:190972697-190972719 AAGAGTTCATAATATAGGCACGG - Intronic
943787824 2:191898264-191898286 AACAACCCACAATATGGGCATGG + Intergenic
943919108 2:193679329-193679351 TTGAATCCACATACTAGGCATGG + Intergenic
945388158 2:209228994-209229016 TACCATTCAGAATATAGGCATGG - Intergenic
945639041 2:212399236-212399258 TAGAATGAACAATATGGGCCAGG - Intronic
947159958 2:227204497-227204519 TAGACTCCACCATATACGAAGGG + Intronic
1170084999 20:12520379-12520401 TAGAATACAGAATATTGGCTGGG - Intergenic
1170226623 20:13997025-13997047 AAGAATCCACTATATAGGATCGG + Intronic
1176856410 21:13978268-13978290 TATAATAAACAATATAGGCTGGG + Intergenic
1177548786 21:22594394-22594416 TAGAAGCTACAAGAGAGGCACGG - Intergenic
1181076487 22:20381387-20381409 TAAAATCAACATTATAGGCTGGG + Intronic
1182632018 22:31693979-31694001 TATAAAACACACTATAGGCAAGG + Intronic
1182917172 22:34045035-34045057 TAGAATTCAGAAAATGGGCATGG - Intergenic
950540106 3:13607279-13607301 AAGAATACAGAATATAGGCTGGG - Intronic
950728698 3:14937137-14937159 TAGAAACCACAAAACAGGCTGGG - Intergenic
950995350 3:17490409-17490431 TAGCATTCAGAACATAGGCATGG - Intronic
952111345 3:30127295-30127317 TACAATTCAGGATATAGGCATGG + Intergenic
953432619 3:42852194-42852216 TAGAATAGACAGAATAGGCAGGG - Intronic
955274954 3:57538404-57538426 TATAAAGCACAATAAAGGCAAGG + Intronic
955847950 3:63187279-63187301 TAATATCCAGAATATATGCAAGG - Intergenic
956506093 3:69941851-69941873 GAAAATAAACAATATAGGCAAGG - Intronic
956998872 3:74860951-74860973 TAGAATCCACTATCTAGTGAGGG - Intergenic
957334403 3:78808496-78808518 TAAAATCCACATTTCAGGCAGGG - Intronic
958530176 3:95319257-95319279 TAGATTCCCTAATATAAGCAAGG + Intergenic
959402902 3:105924139-105924161 TAGAACCCACAAAATAAGAATGG + Intergenic
963630691 3:147726501-147726523 TACCATTCACAACATAGGCACGG + Intergenic
963637255 3:147813913-147813935 TATAATGCACAATAAAGCCATGG - Intergenic
964282460 3:155080887-155080909 TAGAACCCACAAAAATGGCAGGG - Intronic
964364571 3:155935494-155935516 TAGAAGCAACATTATAGGCCAGG - Intronic
965560345 3:170056038-170056060 AAAAATCAACAATATAGGAATGG - Intronic
967566096 3:190974624-190974646 TTGAATCCAGAGTATAGACATGG + Intergenic
968280530 3:197473670-197473692 TAGAATCCCAAATAAAGGCAAGG - Intergenic
969125275 4:4943247-4943269 TAGAATCCACAATTTACAGATGG + Intergenic
969450490 4:7270169-7270191 TAAAATCCACATCATGGGCACGG - Intronic
973562061 4:52147041-52147063 TAGAATATACAATATAGCCTAGG + Intergenic
973981776 4:56314037-56314059 TAGGATCCACAACATGAGCAAGG + Exonic
975022608 4:69507776-69507798 TAGCATTCAGAATATAGACACGG + Intronic
975436016 4:74352348-74352370 CAGGATCCACAAGATAGTCACGG + Intergenic
977218365 4:94310204-94310226 TACAATTCAGGATATAGGCATGG - Intronic
978573998 4:110170108-110170130 TAGAAAACAAAATATAGGCTGGG - Intronic
979614041 4:122721524-122721546 ATGAATCTACAATTTAGGCAGGG + Intergenic
979739019 4:124126889-124126911 TATAATTCAGGATATAGGCATGG - Intergenic
982284186 4:153717319-153717341 AAGAATACACAATATAAGCCTGG - Intronic
983820181 4:172183515-172183537 TTGATTCAACAATGTAGGCAAGG + Intronic
984092509 4:175391595-175391617 TACCATTCACAACATAGGCATGG + Intergenic
984452661 4:179923439-179923461 TAGAATCTCCACTATAGGCTGGG - Intergenic
984453187 4:179930248-179930270 TAGAATTAACTATATAGGCCAGG + Intergenic
986474215 5:8109738-8109760 TAGAATCCATTATATAAACAAGG - Intergenic
986973378 5:13364324-13364346 TAGGATCTACCATATATGCAAGG + Intergenic
987787022 5:22513650-22513672 TAGAATGCACAACACAGGCCAGG + Intronic
988097143 5:26630407-26630429 TAGAATGCAGAATACAGGCGTGG - Intergenic
989197524 5:38730370-38730392 CAGCAGCCACAATATAGACACGG - Intergenic
989232304 5:39100648-39100670 AAGTTTCCACAATATTGGCAGGG + Intergenic
989461536 5:41705100-41705122 TAGAATTCAGGACATAGGCAAGG - Intergenic
990314804 5:54574030-54574052 ATGAATCTACAATGTAGGCAGGG + Intergenic
994348668 5:98718850-98718872 TACCATTCAGAATATAGGCATGG + Intergenic
995651057 5:114368807-114368829 TATAATACAGAATATAAGCAAGG - Intronic
996028352 5:118676806-118676828 TAGACTCCAAAAGTTAGGCAAGG - Intergenic
996100856 5:119444104-119444126 TACCATCCAGGATATAGGCATGG + Intergenic
996950761 5:129122819-129122841 TAGAAGCCACAACACAGGCTAGG - Intergenic
997558951 5:134827567-134827589 TAAAATTCACAATATAGGGCCGG - Intronic
997668764 5:135653409-135653431 CAGTAACCAAAATATAGGCAGGG + Intergenic
998000173 5:138618917-138618939 TAGAAACCACAATACAGGCCTGG + Intronic
998555906 5:143123554-143123576 TAAAATCCACAATGTTGGCCAGG + Intronic
1000480634 5:161769164-161769186 TACCATTCACAACATAGGCATGG + Intergenic
1000520706 5:162291463-162291485 TACCATCCAGGATATAGGCATGG - Intergenic
1000763299 5:165253212-165253234 TAGAATCCACAGTAATGACAGGG - Intergenic
1001215201 5:169849494-169849516 TAGATTCCATGATCTAGGCAAGG - Intronic
1002612633 5:180431470-180431492 TAGAATACAAAATATTGGCCGGG - Intergenic
1005223767 6:23618674-23618696 TATTATCCACATTGTAGGCATGG + Intergenic
1007867748 6:44992004-44992026 TATAATCCACAAAATATTCAAGG + Intronic
1010853307 6:80804514-80804536 TAGCATTCAGAACATAGGCATGG + Intergenic
1018288534 6:162266113-162266135 TAGAAACCTCAAGATAGGCTAGG - Intronic
1019622020 7:1997342-1997364 GAGAAGCCACATTCTAGGCAGGG - Intronic
1020069900 7:5220129-5220151 TAGAAATCAGAATATAGGCCAGG - Intronic
1021102422 7:16599006-16599028 AAAAATCCACAAGATAGGCCGGG + Intergenic
1021932438 7:25595167-25595189 CAGAAATCACAATACAGGCAGGG + Intergenic
1023784771 7:43695001-43695023 TAGAATCAACAAAATAAGCTGGG - Intronic
1025063469 7:55831904-55831926 TTAAAACCACAATAAAGGCAGGG + Intronic
1025172744 7:56775607-56775629 GAGAATGCCCAATATTGGCAAGG + Intergenic
1025699374 7:63802561-63802583 GAGAATGCCCAATATTGGCATGG - Intergenic
1027373225 7:77529454-77529476 TAGAAAACACAAAATAGGCCAGG - Intergenic
1027511318 7:79084591-79084613 TAGAATCCACATTCTTTGCAGGG - Intronic
1027955803 7:84877411-84877433 TAAAATCCACAATCTAGAAACGG - Intergenic
1028531718 7:91845673-91845695 TAGGATCCTGAATATGGGCAAGG + Intronic
1031189279 7:118526168-118526190 TACCATTCAGAATATAGGCAAGG - Intergenic
1031974179 7:128083553-128083575 TAGAATCCCCAATGCATGCAGGG - Intronic
1034531517 7:151698817-151698839 GGGAATCCACATTACAGGCAGGG + Intronic
1035272725 7:157729975-157729997 CAGAAACCACAAGATAGACATGG + Intronic
1036429553 8:8677404-8677426 TAGAAAACACAAAATAGGCTGGG + Intergenic
1037220500 8:16513557-16513579 TAGAAACATCAATATGGGCAAGG - Intronic
1038403315 8:27302696-27302718 TAGAAAATAAAATATAGGCAGGG - Intronic
1039240880 8:35555530-35555552 TAAAATACAAATTATAGGCAGGG + Intronic
1040352823 8:46585644-46585666 TATAATGAAGAATATAGGCATGG - Intergenic
1040717509 8:50275139-50275161 TAAAATCTACTATATAGTCAAGG - Intronic
1041147934 8:54897901-54897923 TGCAATCTACAATAGAGGCAGGG - Intergenic
1042207151 8:66340781-66340803 AAGAAACCACATTATAGTCAGGG + Intergenic
1042554854 8:70025441-70025463 CAGAATCCCCAAGAGAGGCAGGG - Intergenic
1043416936 8:80061068-80061090 AAGAATCCACAAAAAAGGCCAGG + Intronic
1044371525 8:91417817-91417839 TGGAGTCAAAAATATAGGCAAGG - Intergenic
1045933071 8:107649278-107649300 TACCATTCACGATATAGGCATGG - Intergenic
1047239745 8:123075406-123075428 TAAAATCCAAAAACTAGGCAAGG + Intronic
1050341498 9:4644049-4644071 TAGAAATGACAACATAGGCAAGG + Intronic
1052752770 9:32509048-32509070 TAGATTCCTCACTCTAGGCAGGG + Intronic
1056255120 9:84790864-84790886 TAAAATCCACGTTATAGCCAGGG - Intronic
1057320898 9:94011502-94011524 TAACATCCACTTTATAGGCAAGG - Intergenic
1059126549 9:111693008-111693030 TAGAATGTATAATATAGGCTGGG + Intronic
1059253439 9:112907651-112907673 TAGAGTCCACAGGATGGGCAAGG + Intergenic
1061473816 9:130849057-130849079 TACATTCCAGTATATAGGCATGG - Intronic
1186071231 X:5822821-5822843 TAGAATCAGGAATATAGACAGGG - Intergenic
1189527848 X:41844556-41844578 TAAAATCCATAATAAAGGAAGGG - Intronic
1190163835 X:48055151-48055173 TAGAATACTCAAAATAGGCTGGG + Intronic
1191247984 X:58243058-58243080 TAGAATGCCTAAAATAGGCAAGG - Intergenic
1193542900 X:82793368-82793390 TACCATCCAGAACATAGGCATGG + Intergenic
1193618457 X:83719674-83719696 TACCATTCACAACATAGGCATGG + Intergenic
1193844435 X:86451140-86451162 TAATATTCACAACATAGGCACGG - Intronic
1196898756 X:120362706-120362728 TAGAATCCCCAATAGGAGCAGGG + Intronic
1197158683 X:123298805-123298827 TAGCATTCAGAACATAGGCATGG - Intronic
1198989385 X:142493626-142493648 GAGAATCTACATTAGAGGCATGG + Intergenic
1199344069 X:146718480-146718502 AAAATTCCACAATGTAGGCATGG - Intergenic
1202012198 Y:20355456-20355478 TACCATTCAGAATATAGGCATGG + Intergenic