ID: 1154168250

View in Genome Browser
Species Human (GRCh38)
Location 18:12032029-12032051
Sequence CGCTGTTGCTGGAAAGACAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154168250_1154168253 3 Left 1154168250 18:12032029-12032051 CCCTTGTCTTTCCAGCAACAGCG No data
Right 1154168253 18:12032055-12032077 GTTATAGTCATCTTTGAGACTGG No data
1154168250_1154168254 21 Left 1154168250 18:12032029-12032051 CCCTTGTCTTTCCAGCAACAGCG No data
Right 1154168254 18:12032073-12032095 ACTGGCTTTTCTTTCATCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154168250 Original CRISPR CGCTGTTGCTGGAAAGACAA GGG (reversed) Intergenic
No off target data available for this crispr