ID: 1154170744

View in Genome Browser
Species Human (GRCh38)
Location 18:12048328-12048350
Sequence GGCTGCACTGCCTTCATTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154170744_1154170754 26 Left 1154170744 18:12048328-12048350 CCTCCAATGAAGGCAGTGCAGCC No data
Right 1154170754 18:12048377-12048399 TGCCAAGGGCCGTGCAACCCCGG No data
1154170744_1154170750 11 Left 1154170744 18:12048328-12048350 CCTCCAATGAAGGCAGTGCAGCC No data
Right 1154170750 18:12048362-12048384 CCTCAATCTGCTCCCTGCCAAGG No data
1154170744_1154170751 12 Left 1154170744 18:12048328-12048350 CCTCCAATGAAGGCAGTGCAGCC No data
Right 1154170751 18:12048363-12048385 CTCAATCTGCTCCCTGCCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154170744 Original CRISPR GGCTGCACTGCCTTCATTGG AGG (reversed) Intergenic
No off target data available for this crispr