ID: 1154171615

View in Genome Browser
Species Human (GRCh38)
Location 18:12056844-12056866
Sequence CAGAACCCGCTCCCCAGGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 1, 2: 0, 3: 10, 4: 119}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154171613_1154171615 4 Left 1154171613 18:12056817-12056839 CCTAGAAGTGCTGGGGTTCAGGC 0: 1
1: 0
2: 2
3: 25
4: 262
Right 1154171615 18:12056844-12056866 CAGAACCCGCTCCCCAGGATTGG 0: 1
1: 1
2: 0
3: 10
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154171615 Original CRISPR CAGAACCCGCTCCCCAGGAT TGG Intergenic
901687231 1:10949669-10949691 CAGGACCAGCTGCCCAGGAATGG - Exonic
904259589 1:29280617-29280639 CAGCACCCTCTCCCCAGCAGAGG - Intronic
913644671 1:120844825-120844847 CAGACCCTGCTCCCCACGAGGGG - Intergenic
914517788 1:148388773-148388795 CTGAGCCCGCTCCCAAGGCTCGG + Intergenic
914903297 1:151723945-151723967 GAGAGCAAGCTCCCCAGGATAGG - Intronic
916750277 1:167717147-167717169 AAGAACCCTCTCTCCAGGTTCGG - Intergenic
920052529 1:203172391-203172413 CAGCACCTGCTCCCCAGCAGGGG - Intronic
922706424 1:227793098-227793120 CAGGATCCCCTCCCCAGGCTAGG - Intergenic
1067225632 10:44374152-44374174 CAGACCCTGCTCCCCAGGAGTGG + Intronic
1075844001 10:125530272-125530294 CAGAACCCACCACCCAGGGTTGG - Intergenic
1076352419 10:129826147-129826169 CACCACCTGCTCCCCAGGAGGGG - Intergenic
1076590696 10:131580200-131580222 CAGAGCCCTTTCCCCTGGATGGG + Intergenic
1077109079 11:854207-854229 CAGACGCTGCTCCCCAGGGTGGG + Intronic
1078152615 11:8772303-8772325 CACAACCCCCTCCTCAGGTTTGG - Intronic
1080386950 11:31816063-31816085 CAGACCCCGCTCCTCAGGCCCGG + Intronic
1081981449 11:47269669-47269691 CTGCCCCCGCTGCCCAGGATTGG + Exonic
1085277482 11:75309337-75309359 GAGAACTTGCCCCCCAGGATGGG + Intronic
1085445727 11:76599409-76599431 CAGAACCCTCTCCAGAGGAGAGG - Intergenic
1090395183 11:126414153-126414175 CAGAACTCCCTCCCCAAGAGGGG - Exonic
1101741024 12:107500249-107500271 CTGCGCCCGCTCCCCAGGACTGG + Intronic
1101810975 12:108107428-108107450 GAGAACAAGCTCCCCAGGCTGGG + Intergenic
1103919951 12:124394122-124394144 CAGACCCTGCTCCCTAGGTTTGG - Intronic
1105271050 13:18875510-18875532 CCCAACCCGCTCCCCACGATGGG + Intergenic
1112356088 13:98675869-98675891 CAGTGCCCGCTTCCCAGGGTTGG - Intergenic
1112445175 13:99457854-99457876 CAGTGGCCGTTCCCCAGGATGGG + Intergenic
1114540174 14:23449481-23449503 CAGCACCCTCACCCCAGGTTGGG + Intergenic
1115852695 14:37599985-37600007 GAGACCGCGCTCCCCAGGAGGGG - Intronic
1117065946 14:52013633-52013655 GAAAACCCGCTCCCCAAAATGGG + Intronic
1118623868 14:67638990-67639012 CAGAATCCACTACCCAGGTTGGG + Intronic
1118930791 14:70238360-70238382 AATAACCCTATCCCCAGGATTGG - Intergenic
1119426223 14:74536057-74536079 CTGCACCCGCTTCCCAGCATGGG - Intronic
1121238311 14:92409628-92409650 CCTAACATGCTCCCCAGGATAGG + Intronic
1122613725 14:103002652-103002674 CGGAACCTGCTCGCCAGGCTGGG + Intronic
1122807008 14:104264855-104264877 CAGAACCCCATCCCAGGGATAGG - Intergenic
1124597132 15:31100903-31100925 CAGGATTCGCTCCTCAGGATGGG + Intronic
1124668521 15:31616100-31616122 CAGAACAGGCTCCCCAGCAATGG + Intronic
1128058514 15:64718517-64718539 CAGAGCCCCGTGCCCAGGATGGG - Intergenic
1131030508 15:89182418-89182440 CAGGAACTGCTCCCCAGGCTGGG - Intronic
1134017431 16:10898835-10898857 CAGACCCCTCTCCCCAAGGTGGG + Intronic
1138455734 16:57119642-57119664 CAGAGCCCCCTCACCTGGATGGG - Exonic
1142142243 16:88477864-88477886 CAGCAGCAGCTCCCCAGGCTTGG + Intronic
1143188380 17:5023953-5023975 CAGAACCCGCTCCCCGGGATCGG - Exonic
1145908253 17:28528085-28528107 CAGAACCTGCTCCACAGGCAGGG - Intronic
1145941879 17:28747006-28747028 CAGACCCCCCTTCCCAGGACAGG + Intronic
1147137437 17:38442352-38442374 CAGAACCCTGTCCCCAGGAGGGG - Intronic
1147152579 17:38526637-38526659 CAGAGCACGATCCACAGGATGGG - Intergenic
1147332991 17:39709844-39709866 CAGAACTCTCTCCCCAGCAGCGG - Exonic
1147965478 17:44192279-44192301 CAGAGCCCCCTGCCCAGGCTGGG - Exonic
1148519306 17:48255023-48255045 CAGAAGCTCCTCCCCTGGATGGG + Intronic
1148859498 17:50596654-50596676 CAAAAGTCGCACCCCAGGATAGG - Intronic
1150221243 17:63497019-63497041 CTTAACCCCCTCCCCAGGCTGGG + Intronic
1151589741 17:75035277-75035299 CAGAAGCAGCTCCCCAGCTTCGG - Intronic
1153967195 18:10192614-10192636 CAGAGCCTGCTGCCCTGGATGGG + Intergenic
1154107133 18:11533160-11533182 CCCAATCCGCTCCCCACGATGGG - Intergenic
1154170506 18:12047436-12047458 CCCAACCCACTCCCCATGATGGG + Intergenic
1154171615 18:12056844-12056866 CAGAACCCGCTCCCCAGGATTGG + Intergenic
1154416528 18:14178517-14178539 CCCAACCCGCTCCCCACGATGGG - Intergenic
1156364024 18:36408977-36408999 CAGACCCAGCTCCCCAGCAGGGG - Intronic
1160100078 18:75912446-75912468 CAGACCCCTCTCCCCAGTGTGGG + Intergenic
1160496656 18:79380022-79380044 CAGAATGCTCTCCCCAGGCTGGG - Intergenic
1162475219 19:10895702-10895724 CAGAATGCCCTCCCCGGGATAGG - Intronic
1163692896 19:18746766-18746788 CAGAACCCCCTCCCTTGGAAGGG + Intronic
1164251055 19:23475918-23475940 CAGAACTCACTCCCAAGTATGGG - Intergenic
1165890911 19:39111772-39111794 CAGAAACCGCGCCCCATGACGGG - Intergenic
1166098425 19:40555997-40556019 CTAAACCCCCTCCCCAGGACAGG - Intronic
1166303766 19:41926539-41926561 CAGAACTGGCTCCCCAGGGAGGG - Intronic
1166310226 19:41958586-41958608 CAGGCCCCGCCCCCAAGGATTGG - Intronic
1166732083 19:45064680-45064702 GAGCACCTTCTCCCCAGGATCGG - Intronic
928186002 2:29111435-29111457 TAAAACCCGCTCCCCAGGGAAGG - Intronic
931752807 2:65346110-65346132 CAGAACCTGGTCCCCACAATTGG + Intronic
933368694 2:81388223-81388245 GAGACCCCGGTCCCCAGGAAAGG + Intergenic
938759780 2:134413350-134413372 AAGAATCTGCTCCCCATGATGGG + Intronic
945034894 2:205696319-205696341 CAGCAGCCGCCCTCCAGGATGGG - Intronic
946578361 2:221100824-221100846 CAGAGCCCGCAGCCCAGGGTGGG + Intergenic
1169214115 20:3783953-3783975 CAGGCCCCTCTGCCCAGGATGGG + Exonic
1171296657 20:24023038-24023060 CAGAAGCTGCTCCTCAGGAGAGG + Intergenic
1172488194 20:35312589-35312611 CAGGAACCGCTTCCCAGGAGGGG + Intronic
1172886655 20:38235810-38235832 CAAAACCCCATCCCCAGCATGGG + Intronic
1173628502 20:44491751-44491773 CAGAACCCACTGGCCTGGATGGG + Exonic
1173679612 20:44868608-44868630 CAGACCCCCATCCCCAGGATGGG - Intergenic
1174360588 20:50026716-50026738 CAGAATCTTCTCCCCAGGGTTGG + Intergenic
1174576587 20:51542068-51542090 CAGCACCCGCCCCCCAGCCTTGG + Intronic
1176856800 21:13980741-13980763 CCCAACCCGCTCCCCACGATGGG + Intergenic
1176867780 21:14063472-14063494 CCCAACCCGCTCCCCACGATGGG - Intergenic
1178750234 21:35295909-35295931 TAGAATTCCCTCCCCAGGATGGG + Intronic
1178909533 21:36663451-36663473 CAGAACACGCTCCACAGGGAAGG + Intergenic
1179527613 21:41993123-41993145 CAGAACCAGATCCACTGGATGGG + Exonic
1180067134 21:45418141-45418163 CAGAGCCGGCTCCCCTGGAAGGG - Intronic
1180842260 22:18964931-18964953 CAGAACCCCCTCCTCACGCTGGG + Intergenic
950476814 3:13220006-13220028 CAGACCCCGGTTCCCAGGACTGG - Intergenic
950483103 3:13256849-13256871 CTGCACCCTCTCCCCAGGGTAGG - Intergenic
951194002 3:19803968-19803990 GAGCACCTGCTCACCAGGATTGG + Intergenic
952347514 3:32502559-32502581 CAGACCCCGCTCCCCAGCCCGGG + Intronic
953349783 3:42206871-42206893 CCTCACCCGCTCCCAAGGATGGG - Intronic
955347016 3:58168689-58168711 CACAACCAGCTCCCCAGGAAGGG - Intronic
955487761 3:59451960-59451982 CAGTACCCACTTCCCAGAATTGG + Intergenic
960994537 3:123332275-123332297 CACCACCCGCTTCCAAGGATGGG + Intronic
962616119 3:137128348-137128370 CAGAACCCACCCCACAGCATGGG - Intergenic
964555731 3:157936121-157936143 GAAAACTCACTCCCCAGGATGGG + Intergenic
969153173 4:5187565-5187587 AACAACCAGCTCTCCAGGATGGG + Intronic
982321964 4:154086303-154086325 CAGAAACTGCTCCCCAGTACAGG - Intergenic
985008938 4:185562623-185562645 CAGTGCCTGCTCCTCAGGATCGG + Intergenic
985517505 5:354448-354470 CAGAAGCCCCTCCCCACGAGAGG - Intronic
986136546 5:4985163-4985185 CAGACTGCGCTCCCCAGCATGGG + Intergenic
987101346 5:14593852-14593874 CAGCACCATCCCCCCAGGATGGG - Intronic
988787404 5:34577721-34577743 CAGACCGCCCTCCCCAGTATGGG + Intergenic
998092220 5:139378233-139378255 CAGAACATGCCCCCCAGGATGGG + Exonic
999364023 5:151009676-151009698 CCTAACCTGGTCCCCAGGATAGG - Intergenic
1001470049 5:172005963-172005985 CAGCACCCACTCCCCAGCCTAGG - Intronic
1002525897 5:179816073-179816095 CAGGGCCCGCACCCCAGGACGGG - Intronic
1006260151 6:32861159-32861181 GAAAACCCACTCCCCAGGAGGGG - Intergenic
1007814265 6:44509348-44509370 CTGACCCTGCTCCCCAGTATGGG - Intergenic
1014127532 6:117794251-117794273 GAGCACCCCCTCCCCAGAATTGG + Intergenic
1018621425 6:165732840-165732862 CAGATGCCACTCACCAGGATGGG - Intronic
1022466573 7:30656314-30656336 CCCAACCCTCTCCCCAGTATAGG + Intronic
1022965609 7:35468558-35468580 CAGAGACCTCTCCCCAGGATGGG + Intergenic
1028789220 7:94834536-94834558 CAGAACCTGCTTCCCTGGTTTGG + Intergenic
1029312000 7:99676021-99676043 CAGAACTCCCTCCCAAGGAGGGG + Intronic
1030250743 7:107441284-107441306 CACAACTCCCTCCTCAGGATTGG - Intronic
1035209017 7:157314123-157314145 CAGAGCCCGCTCCCAGGGCTGGG - Intergenic
1037653443 8:20862038-20862060 CAGAACTAGCTCCCAAGCATGGG + Intergenic
1045008037 8:97932940-97932962 CAGCACCAACTCCCCAGGAGAGG + Intronic
1048928352 8:139290973-139290995 CAGAGCCCTCTGCCCAAGATGGG + Intergenic
1048991048 8:139760331-139760353 CAGTTCCCACTCCCCAGGGTGGG - Intronic
1057439591 9:95073270-95073292 CAGCTCCAGCTCCCCAAGATGGG - Intronic
1057996309 9:99823893-99823915 CCGCCCCCGCTCCCCAGGGTTGG + Intronic
1062009573 9:134259735-134259757 CTGCACCTGCGCCCCAGGATGGG - Intergenic
1062523811 9:136970302-136970324 CAGGACCCCCTCCCCAGGCAGGG - Intronic
1187756984 X:22539025-22539047 CAGCAGCTGCTCCCCAGTATTGG + Intergenic
1190735155 X:53250950-53250972 CAGAACCCCCACCCCAGGGCCGG - Exonic
1197870352 X:131058112-131058134 CAGAATCAGCTTCCCAGGACAGG + Intergenic