ID: 1154173755

View in Genome Browser
Species Human (GRCh38)
Location 18:12068349-12068371
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 47}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154173755_1154173760 -9 Left 1154173755 18:12068349-12068371 CCCAAGTCAGCTTCTCGCGGGCC 0: 1
1: 0
2: 0
3: 1
4: 47
Right 1154173760 18:12068363-12068385 TCGCGGGCCTGGCTGTCGGAGGG No data
1154173755_1154173763 17 Left 1154173755 18:12068349-12068371 CCCAAGTCAGCTTCTCGCGGGCC 0: 1
1: 0
2: 0
3: 1
4: 47
Right 1154173763 18:12068389-12068411 GGCCGAACCCTTGCCCCTCTTGG 0: 1
1: 1
2: 0
3: 6
4: 72
1154173755_1154173759 -10 Left 1154173755 18:12068349-12068371 CCCAAGTCAGCTTCTCGCGGGCC 0: 1
1: 0
2: 0
3: 1
4: 47
Right 1154173759 18:12068362-12068384 CTCGCGGGCCTGGCTGTCGGAGG No data
1154173755_1154173761 -4 Left 1154173755 18:12068349-12068371 CCCAAGTCAGCTTCTCGCGGGCC 0: 1
1: 0
2: 0
3: 1
4: 47
Right 1154173761 18:12068368-12068390 GGCCTGGCTGTCGGAGGGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154173755 Original CRISPR GGCCCGCGAGAAGCTGACTT GGG (reversed) Intergenic