ID: 1154173756

View in Genome Browser
Species Human (GRCh38)
Location 18:12068350-12068372
Sequence AGGCCCGCGAGAAGCTGACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 55}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154173756_1154173763 16 Left 1154173756 18:12068350-12068372 CCAAGTCAGCTTCTCGCGGGCCT 0: 1
1: 0
2: 0
3: 4
4: 55
Right 1154173763 18:12068389-12068411 GGCCGAACCCTTGCCCCTCTTGG 0: 1
1: 1
2: 0
3: 6
4: 72
1154173756_1154173761 -5 Left 1154173756 18:12068350-12068372 CCAAGTCAGCTTCTCGCGGGCCT 0: 1
1: 0
2: 0
3: 4
4: 55
Right 1154173761 18:12068368-12068390 GGCCTGGCTGTCGGAGGGCACGG No data
1154173756_1154173760 -10 Left 1154173756 18:12068350-12068372 CCAAGTCAGCTTCTCGCGGGCCT 0: 1
1: 0
2: 0
3: 4
4: 55
Right 1154173760 18:12068363-12068385 TCGCGGGCCTGGCTGTCGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154173756 Original CRISPR AGGCCCGCGAGAAGCTGACT TGG (reversed) Intergenic