ID: 1154173759

View in Genome Browser
Species Human (GRCh38)
Location 18:12068362-12068384
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154173755_1154173759 -10 Left 1154173755 18:12068349-12068371 CCCAAGTCAGCTTCTCGCGGGCC 0: 1
1: 0
2: 0
3: 1
4: 47
Right 1154173759 18:12068362-12068384 CTCGCGGGCCTGGCTGTCGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154173759 Original CRISPR CTCGCGGGCCTGGCTGTCGG AGG Intergenic