ID: 1154173761

View in Genome Browser
Species Human (GRCh38)
Location 18:12068368-12068390
Sequence GGCCTGGCTGTCGGAGGGCA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154173755_1154173761 -4 Left 1154173755 18:12068349-12068371 CCCAAGTCAGCTTCTCGCGGGCC 0: 1
1: 0
2: 0
3: 1
4: 47
Right 1154173761 18:12068368-12068390 GGCCTGGCTGTCGGAGGGCACGG No data
1154173756_1154173761 -5 Left 1154173756 18:12068350-12068372 CCAAGTCAGCTTCTCGCGGGCCT 0: 1
1: 0
2: 0
3: 4
4: 55
Right 1154173761 18:12068368-12068390 GGCCTGGCTGTCGGAGGGCACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154173761 Original CRISPR GGCCTGGCTGTCGGAGGGCA CGG Intergenic