ID: 1154173762

View in Genome Browser
Species Human (GRCh38)
Location 18:12068370-12068392
Sequence GGCCGTGCCCTCCGACAGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154173762_1154173770 30 Left 1154173762 18:12068370-12068392 CCTGGCTGTCGGAGGGCACGGCC No data
Right 1154173770 18:12068423-12068445 CTCCGCGCCGCCGCCGCCGCCGG No data
1154173762_1154173763 -4 Left 1154173762 18:12068370-12068392 CCTGGCTGTCGGAGGGCACGGCC No data
Right 1154173763 18:12068389-12068411 GGCCGAACCCTTGCCCCTCTTGG 0: 1
1: 1
2: 0
3: 6
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154173762 Original CRISPR GGCCGTGCCCTCCGACAGCC AGG (reversed) Intergenic
No off target data available for this crispr