ID: 1154173763

View in Genome Browser
Species Human (GRCh38)
Location 18:12068389-12068411
Sequence GGCCGAACCCTTGCCCCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 80
Summary {0: 1, 1: 1, 2: 0, 3: 6, 4: 72}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154173755_1154173763 17 Left 1154173755 18:12068349-12068371 CCCAAGTCAGCTTCTCGCGGGCC 0: 1
1: 0
2: 0
3: 1
4: 47
Right 1154173763 18:12068389-12068411 GGCCGAACCCTTGCCCCTCTTGG 0: 1
1: 1
2: 0
3: 6
4: 72
1154173762_1154173763 -4 Left 1154173762 18:12068370-12068392 CCTGGCTGTCGGAGGGCACGGCC No data
Right 1154173763 18:12068389-12068411 GGCCGAACCCTTGCCCCTCTTGG 0: 1
1: 1
2: 0
3: 6
4: 72
1154173756_1154173763 16 Left 1154173756 18:12068350-12068372 CCAAGTCAGCTTCTCGCGGGCCT 0: 1
1: 0
2: 0
3: 4
4: 55
Right 1154173763 18:12068389-12068411 GGCCGAACCCTTGCCCCTCTTGG 0: 1
1: 1
2: 0
3: 6
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154173763 Original CRISPR GGCCGAACCCTTGCCCCTCT TGG Intergenic