ID: 1154173764

View in Genome Browser
Species Human (GRCh38)
Location 18:12068391-12068413
Sequence CGCCAAGAGGGGCAAGGGTT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 1, 2: 0, 3: 7, 4: 145}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154173764_1154173771 10 Left 1154173764 18:12068391-12068413 CCGAACCCTTGCCCCTCTTGGCG 0: 1
1: 1
2: 0
3: 7
4: 145
Right 1154173771 18:12068424-12068446 TCCGCGCCGCCGCCGCCGCCGGG No data
1154173764_1154173770 9 Left 1154173764 18:12068391-12068413 CCGAACCCTTGCCCCTCTTGGCG 0: 1
1: 1
2: 0
3: 7
4: 145
Right 1154173770 18:12068423-12068445 CTCCGCGCCGCCGCCGCCGCCGG No data
1154173764_1154173778 26 Left 1154173764 18:12068391-12068413 CCGAACCCTTGCCCCTCTTGGCG 0: 1
1: 1
2: 0
3: 7
4: 145
Right 1154173778 18:12068440-12068462 CGCCGGGGCCCACACCTGTCAGG No data
1154173764_1154173773 11 Left 1154173764 18:12068391-12068413 CCGAACCCTTGCCCCTCTTGGCG 0: 1
1: 1
2: 0
3: 7
4: 145
Right 1154173773 18:12068425-12068447 CCGCGCCGCCGCCGCCGCCGGGG No data
1154173764_1154173780 29 Left 1154173764 18:12068391-12068413 CCGAACCCTTGCCCCTCTTGGCG 0: 1
1: 1
2: 0
3: 7
4: 145
Right 1154173780 18:12068443-12068465 CGGGGCCCACACCTGTCAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154173764 Original CRISPR CGCCAAGAGGGGCAAGGGTT CGG (reversed) Intergenic
900077153 1:827148-827170 GGCCAAGAGGGGCGAGGGTGGGG + Intergenic
901183456 1:7357306-7357328 AGCCAAAAAGGGCAAGGCTTGGG - Intronic
904619161 1:31765152-31765174 TGCCAAGATGGGGAAGGGGTGGG - Intergenic
905390167 1:37631091-37631113 AGCCTAGAGGGGAAAGGATTAGG - Intronic
906238015 1:44223379-44223401 GCCTAAGAGGGGGAAGGGTTAGG + Intronic
914918485 1:151832383-151832405 TGGCAAGAGCAGCAAGGGTTAGG - Intergenic
915732614 1:158064964-158064986 GGGAAAGAGGGGCAAGAGTTGGG + Intronic
918245348 1:182654653-182654675 CTCTAAGAGTGGGAAGGGTTTGG + Intronic
920304166 1:205008245-205008267 CCCCAAGAGGAGCAAAGGGTGGG + Intronic
921938551 1:220816766-220816788 CAGCAAGAGGGGCAAGGGAGAGG - Exonic
923314581 1:232767450-232767472 GGGCAAGAGGGGCAAGGTTTTGG + Intergenic
1064512713 10:16112738-16112760 TGTCAAGGGGAGCAAGGGTTGGG + Intergenic
1070952576 10:80442986-80443008 GGCCAGGAGGGGCTAGGGTGTGG + Intergenic
1072350847 10:94555459-94555481 CCCCAAAAGGGGACAGGGTTTGG + Intronic
1072740042 10:97903754-97903776 CAGCATGAGGGGCATGGGTTTGG - Intronic
1072856435 10:98952376-98952398 GGGCAAAATGGGCAAGGGTTTGG + Intronic
1073175831 10:101556932-101556954 GTCCAAGAAGGGGAAGGGTTAGG - Exonic
1074187403 10:111108698-111108720 CGCCAGTAGGGGCAGGGGCTGGG + Intergenic
1076725459 10:132410909-132410931 GGGCAGGAGGGGAAAGGGTTGGG - Intronic
1078061557 11:8049148-8049170 TTCCTAGAAGGGCAAGGGTTTGG - Intronic
1080713489 11:34773320-34773342 CGCCAATAGGCACAAGGGTTGGG - Intergenic
1083336158 11:61922984-61923006 TGGCAAGAGGGGAAAGGGCTTGG + Intergenic
1084916001 11:72429562-72429584 GGCCAAGAGAGGCCAAGGTTAGG + Intronic
1085279747 11:75322178-75322200 CTCCAAAAGGGACAAGGGCTGGG + Intronic
1096743845 12:53712992-53713014 GGCCAAGAAGGGCAGGGGTTGGG + Intronic
1097213488 12:57391311-57391333 AGCTAAGTGGGGCAGGGGTTGGG + Intronic
1098524324 12:71469577-71469599 AGCCAAGAGGGGCAGGAGATGGG + Intronic
1098685512 12:73415025-73415047 GGCCTAGAGGGGCAAAGGGTTGG - Intergenic
1100442896 12:94633543-94633565 CACAAAGAGGGGCAAATGTTTGG - Intronic
1103369592 12:120408763-120408785 GTCCAGGAGGGGCCAGGGTTTGG - Intergenic
1106466817 13:30021085-30021107 CCCCAAGGTGGGCAAGGGCTTGG - Intergenic
1106930084 13:34653952-34653974 CTCCATTAGGGACAAGGGTTGGG + Intergenic
1107045035 13:35984825-35984847 AGCCAAGCGGGGAAGGGGTTGGG - Intronic
1113853426 13:113430895-113430917 TGCCCAGTGGGGCAAGGGCTCGG - Intronic
1116037610 14:39646598-39646620 CTACAAGAGGGGGAAGGGTGCGG - Intergenic
1121733266 14:96201276-96201298 CGCCATGCGGGGCTAGGGCTGGG + Intergenic
1122689210 14:103523509-103523531 TGCGAAGAGGGCCCAGGGTTGGG - Intergenic
1123538545 15:21262515-21262537 CGCCTCTGGGGGCAAGGGTTGGG - Intergenic
1130260338 15:82349164-82349186 AGCCCAGAGGGGCTGGGGTTGGG + Intronic
1130268392 15:82430269-82430291 AGCCCAGAGGGGCTGGGGTTGGG - Intronic
1130280895 15:82519843-82519865 AGCCCAGAGGGGCTGGGGTTGGG - Intergenic
1130472265 15:84236024-84236046 AGCCCAGAGGGGCTGGGGTTGGG - Intronic
1130479758 15:84350595-84350617 AGCCCAGAGGGGCTGGGGTTGGG - Intergenic
1130492012 15:84437534-84437556 AGCCCAGAGGGGCTGGGGTTGGG + Intergenic
1130503628 15:84516574-84516596 AGCCCAGAGGGGCTGGGGTTGGG + Intergenic
1130535832 15:84784360-84784382 CGCATAGAGGGGCACGGGGTTGG - Exonic
1132349875 15:101133087-101133109 CCACAAGAGGGGCAGTGGTTAGG - Intergenic
1132690861 16:1181233-1181255 GACCAAGATGGGCAAGGGTGAGG + Intronic
1132705148 16:1240312-1240334 CCCCAAGAGGGACACGGGTGAGG - Intergenic
1132718914 16:1306407-1306429 TGCCAGGAGGGGCTGGGGTTTGG - Intergenic
1139953859 16:70684361-70684383 CACCATGAGGGGCAGGGGGTGGG + Intronic
1142226493 16:88880247-88880269 CAGCAAGAGGGGTTAGGGTTGGG - Intronic
1142957727 17:3532656-3532678 CGCCAAGATGGGCAAGGCGGAGG - Exonic
1143109743 17:4546358-4546380 GGCCAAGGGGGGCAAGGGGGTGG - Intronic
1143376490 17:6470504-6470526 CCCCACGTGGGGCACGGGTTTGG + Intronic
1145351777 17:22090125-22090147 TGCCTCGGGGGGCAAGGGTTGGG - Intergenic
1146583124 17:34057673-34057695 AGGCAAGAGGGTCAAGGATTAGG + Intronic
1147363589 17:39946147-39946169 TGCAAAGAGGGGCAAGGGGAAGG + Intergenic
1151356458 17:73561357-73561379 CTCCAAAAGGGGCTAGGGTAGGG + Intronic
1152358391 17:79817751-79817773 TGCCAAGAAGGGGAAGTGTTGGG + Intergenic
1152820290 17:82434322-82434344 TGGCAGGAGGGGCAAGGGTGGGG - Intronic
1153822876 18:8847371-8847393 CCCCAAGTGGGGCATGGGTAGGG - Intergenic
1154173764 18:12068391-12068413 CGCCAAGAGGGGCAAGGGTTCGG - Intergenic
1161784036 19:6312043-6312065 CCCAAAGAGGGTCAAGGGTGGGG + Intronic
1163631408 19:18419654-18419676 CGCCAAGGGGGGCAAGGGTTCGG + Exonic
1164696706 19:30250290-30250312 CAACAAGAGGGGAAAGGGTTAGG - Intronic
1165149376 19:33751927-33751949 CGCCAGGAGGGGTCAGGGATCGG + Intronic
1165272739 19:34724586-34724608 AGCCGAGGGGGCCAAGGGTTGGG - Intergenic
1165778725 19:38420019-38420041 GGCCAAGAGGGGCAGGGTATTGG + Intronic
1166525060 19:43505256-43505278 CGCCCAGAGAGGAAAGGGTCTGG - Intergenic
1167138489 19:47632927-47632949 CCCGAAGTGGTGCAAGGGTTCGG + Intronic
1167479264 19:49719530-49719552 CGCCAAGAAGGGCCAGGGTGAGG - Intergenic
1168113374 19:54207521-54207543 TGCCAAGAAGGGCCAGGGTGGGG + Exonic
1168327099 19:55544073-55544095 GGCCACGAGGGACAAAGGTTGGG - Intronic
925973241 2:9122376-9122398 TGTCCAGTGGGGCAAGGGTTGGG - Intergenic
931884747 2:66605030-66605052 AGCTCAGAGGAGCAAGGGTTGGG + Intergenic
933063546 2:77767962-77767984 TGCCAAGAAGCACAAGGGTTTGG + Intergenic
937221334 2:120344648-120344670 CGCCCAGCTGGGCAAGGGTCCGG + Intergenic
938099432 2:128488195-128488217 CGCCATGTGGGGCATGGGATAGG + Intergenic
938757713 2:134396086-134396108 CTCCTAGAGAGGTAAGGGTTTGG + Intronic
941087550 2:161135056-161135078 AGCCAGGATTGGCAAGGGTTAGG - Intergenic
948514387 2:238494577-238494599 CGGAGAGAGGGCCAAGGGTTCGG - Intergenic
1171110485 20:22476431-22476453 CAGCGAGAGGGGCAGGGGTTGGG + Intergenic
1171562112 20:26135346-26135368 CGCCTCTGGGGGCAAGGGTTGGG - Intergenic
1172930330 20:38581975-38581997 CACCAAGAGGAGCAAGAGGTGGG + Intronic
1172999092 20:39092601-39092623 CTCCAAGAGGTGAAAGGATTTGG - Intergenic
1173146291 20:40527422-40527444 CTCCAAGAGGGACAGGGGTAGGG - Intergenic
1173656390 20:44703032-44703054 GGCCAAGAGGGGCTGAGGTTTGG + Intergenic
1174076005 20:47937467-47937489 AGCCAAGATGGGCATGAGTTTGG - Intergenic
1175817507 20:61891144-61891166 CGCCATGTGGGGCAAATGTTGGG + Intronic
1180092408 21:45539837-45539859 AGGGAAGAGGGGGAAGGGTTAGG + Intronic
1180231406 21:46428813-46428835 GGGCAAGAGGGGCCTGGGTTGGG + Intronic
1180706234 22:17811664-17811686 CAACAAGAGGGGCAAAGATTGGG + Intronic
1183142351 22:35954637-35954659 AACCAAGTGGGGCAAGGCTTGGG - Intronic
1183909006 22:41064582-41064604 TGCCAAGAAGGGCCAGGGTGGGG + Intergenic
1184669977 22:46007338-46007360 CGCTAGGAGAGGCAAGGGGTGGG + Intergenic
1185093100 22:48786809-48786831 TGCCCAGAGGGGCCAGGGCTGGG - Intronic
950199746 3:11034590-11034612 CCCCAAGTGGGGCCAGGGTGTGG + Exonic
951042736 3:18005601-18005623 ACCCAGGAAGGGCAAGGGTTCGG - Intronic
953571776 3:44076766-44076788 AGCCAAGATGGGAAAGGGGTAGG + Intergenic
959692887 3:109218773-109218795 ACCCAGGAAGGGCAAGGGTTCGG + Intergenic
961096274 3:124159228-124159250 AGCCATGTGGGCCAAGGGTTAGG - Intronic
961943213 3:130658031-130658053 GGCCAAGTTGGGAAAGGGTTGGG + Intronic
964499652 3:157334803-157334825 CACCTAGAGGAGCAAGAGTTTGG + Intronic
978033582 4:103968041-103968063 GGCCAAAAGGGGCTAGAGTTGGG + Intergenic
985847365 5:2360266-2360288 GGCCAGGGAGGGCAAGGGTTAGG - Intergenic
985883343 5:2657283-2657305 CGCCATGAGGGGTAAAGGGTTGG + Intergenic
986290357 5:6394845-6394867 CGCATGGAGGAGCAAGGGTTGGG + Intergenic
986442622 5:7795147-7795169 AGCCAAGAGGTGCCAGGGCTGGG - Intronic
989436586 5:41420553-41420575 AGCTAAGAGGGGAAGGGGTTTGG - Intronic
992232527 5:74677309-74677331 GGCCCAGAGAGGCAAGAGTTTGG - Intronic
993440505 5:87951087-87951109 ACCCTATAGGGGCAAGGGTTGGG - Intergenic
994360807 5:98846314-98846336 CCCCAAGAGCGACAAGGGGTCGG + Intergenic
995039407 5:107571104-107571126 GGCCCAGGGCGGCAAGGGTTGGG + Intronic
997981379 5:138469731-138469753 AGCCAAGAAAGGCAAGAGTTAGG + Intergenic
1001693758 5:173654021-173654043 CACCAAGTGAGGGAAGGGTTAGG + Intergenic
1006169753 6:32086093-32086115 CCCCAAGAGGCCCAAGGGTGAGG + Intronic
1009693351 6:67064963-67064985 GGCCAAAAGGAGCAGGGGTTGGG - Intergenic
1018788205 6:167125395-167125417 CCCCAAGAAGAGCAGGGGTTGGG - Intronic
1019331226 7:461827-461849 AGCCAAGAGGCCCAAGGGTGAGG + Intergenic
1019565632 7:1677650-1677672 GTCCAAGAGGGGAAAGGGGTGGG - Intergenic
1022734989 7:33067837-33067859 CTCCAAGTGGTGCAAGGGTAGGG + Intergenic
1022780879 7:33582101-33582123 AGCAAAGAGGGGCTAGGGGTAGG - Intronic
1023876873 7:44291210-44291232 CGCCAAGTGGGGAGAGTGTTGGG + Intronic
1023876882 7:44291237-44291259 CGCCAAGGGGGGAGAGTGTTTGG + Intronic
1026037445 7:66839988-66840010 CGCCTGGAGGGGCAAGGCTGGGG - Intergenic
1026959002 7:74396885-74396907 GCCCAAGAGGGGCCAGGATTTGG - Intronic
1027214225 7:76173663-76173685 CGCCTGGAGGGGCAAGGCTGGGG + Intergenic
1033506275 7:142004529-142004551 CTCCAAAAGGAGAAAGGGTTAGG + Intronic
1035516018 8:232729-232751 GGCCAAGAGGGGCGAGGGTGGGG - Intronic
1038168505 8:25107568-25107590 CACCAAGAGGGGCAAGAATGAGG + Intergenic
1038273595 8:26098593-26098615 GGACAAAAGGGGCAAGGGTGGGG - Intergenic
1039795003 8:40905451-40905473 AACCAAGAGGGGCAATGGTGGGG - Intergenic
1041573778 8:59369728-59369750 CTCCATGAGGGTTAAGGGTTTGG - Intergenic
1045348635 8:101317477-101317499 TGCCACGTGGGGCAAGGGCTAGG - Intergenic
1045544727 8:103118302-103118324 CACCCAGAAGGGAAAGGGTTTGG + Intergenic
1047206894 8:122809677-122809699 TGACAAGTGGGGCAAGGGTGTGG - Intronic
1047798015 8:128277791-128277813 CGTCAAGTGGGGACAGGGTTAGG - Intergenic
1051058555 9:13017987-13018009 CTCCAAGCTGGGCAAGAGTTGGG - Intergenic
1051088613 9:13380590-13380612 CACCAATAGAGGCAAGAGTTTGG + Intergenic
1051423932 9:16915645-16915667 TGCCAAGAGGGGGAAAGGTCAGG - Intergenic
1052755604 9:32537784-32537806 CACCAACAGGGGCAAGGAATGGG - Intergenic
1053310004 9:37011857-37011879 CTCCAAGGGAGGCAAGGGCTGGG + Intronic
1056786619 9:89597176-89597198 CGCCAAAAGGTGCAAGGTATAGG - Intergenic
1060298046 9:122356294-122356316 TCCCAAGAGGTGGAAGGGTTGGG + Intergenic
1062722930 9:138053767-138053789 GGCCATGAGGGGGAAGGGTAGGG - Intronic
1192446618 X:71215776-71215798 AGCCAACAGGGCCAAGGATTTGG + Intronic
1192699048 X:73448174-73448196 CGCTCAGATGGGTAAGGGTTTGG - Intronic
1195138065 X:101931310-101931332 GGCCAAGAGGGTCAAGGATAAGG - Intronic
1195348826 X:103977844-103977866 GGTCAAGAGGGAAAAGGGTTCGG + Intergenic
1195358617 X:104060995-104061017 GGTCAAGAGGGAAAAGGGTTCGG - Intergenic
1197737656 X:129863694-129863716 TGCCAATAGGGGCAAGGCTAAGG + Intergenic
1200091626 X:153638724-153638746 GGCCAGGCGGGGCAAAGGTTGGG + Intergenic
1200332687 X:155314066-155314088 CACCAAGTGGGGGCAGGGTTAGG - Intronic