ID: 1154173765

View in Genome Browser
Species Human (GRCh38)
Location 18:12068396-12068418
Sequence ACGTACGCCAAGAGGGGCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 35
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 32}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154173765_1154173778 21 Left 1154173765 18:12068396-12068418 CCCTTGCCCCTCTTGGCGTACGT 0: 1
1: 0
2: 1
3: 1
4: 32
Right 1154173778 18:12068440-12068462 CGCCGGGGCCCACACCTGTCAGG No data
1154173765_1154173780 24 Left 1154173765 18:12068396-12068418 CCCTTGCCCCTCTTGGCGTACGT 0: 1
1: 0
2: 1
3: 1
4: 32
Right 1154173780 18:12068443-12068465 CGGGGCCCACACCTGTCAGGCGG No data
1154173765_1154173773 6 Left 1154173765 18:12068396-12068418 CCCTTGCCCCTCTTGGCGTACGT 0: 1
1: 0
2: 1
3: 1
4: 32
Right 1154173773 18:12068425-12068447 CCGCGCCGCCGCCGCCGCCGGGG No data
1154173765_1154173771 5 Left 1154173765 18:12068396-12068418 CCCTTGCCCCTCTTGGCGTACGT 0: 1
1: 0
2: 1
3: 1
4: 32
Right 1154173771 18:12068424-12068446 TCCGCGCCGCCGCCGCCGCCGGG No data
1154173765_1154173770 4 Left 1154173765 18:12068396-12068418 CCCTTGCCCCTCTTGGCGTACGT 0: 1
1: 0
2: 1
3: 1
4: 32
Right 1154173770 18:12068423-12068445 CTCCGCGCCGCCGCCGCCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154173765 Original CRISPR ACGTACGCCAAGAGGGGCAA GGG (reversed) Intergenic
908851028 1:68375810-68375832 AGGGACCCAAAGAGGGGCAATGG - Intergenic
924160517 1:241227106-241227128 ACTTATGTCAAGAGGGGAAAAGG + Intronic
1071867307 10:89748703-89748725 ACATTCACCAAGAGGGACAAAGG - Intronic
1077691218 11:4344490-4344512 ACGAACACAAAGAAGGGCAATGG - Intergenic
1084462766 11:69305300-69305322 ATGAAGGCCCAGAGGGGCAAAGG - Intronic
1091651642 12:2314554-2314576 AAGTACAACAAGAGGGGAAATGG - Intronic
1109183672 13:59244972-59244994 AAATAGGCCAAAAGGGGCAATGG + Intergenic
1114690065 14:24573324-24573346 ACATATGGCAAAAGGGGCAAGGG - Intergenic
1129451166 15:75652126-75652148 ACTAAGGCCCAGAGGGGCAAAGG - Intronic
1142501677 17:336592-336614 CTGTACGTGAAGAGGGGCAACGG - Intronic
1154173765 18:12068396-12068418 ACGTACGCCAAGAGGGGCAAGGG - Intergenic
1157865064 18:51175651-51175673 ACATTCACCAAGAGAGGCAATGG + Exonic
1161116575 19:2500373-2500395 GCGTACGCCAAGACAGGCCAGGG - Intergenic
1163631407 19:18419649-18419671 ATGTACGCCAAGGGGGGCAAGGG + Exonic
1165391715 19:35542864-35542886 GCATACCCCAAGAGGGGTAAGGG + Intronic
1167479265 19:49719535-49719557 AAGAACGCCAAGAAGGGCCAGGG - Intergenic
928713404 2:34032787-34032809 ACGTAACTCAAAAGGGGCAAAGG - Intergenic
946582254 2:221142313-221142335 GCCTACGCCAAGAGGACCAAAGG + Intergenic
1175532530 20:59683988-59684010 AAGAACGCAGAGAGGGGCAATGG + Intronic
1181973940 22:26714803-26714825 ATGTACGACAGGAGGGGCCAAGG - Intergenic
952944398 3:38467959-38467981 ACTTAAGCCTAGAGGGGCAGTGG - Intronic
962979660 3:140476481-140476503 ACGTACTCCAAGAGGGTAAAAGG + Intronic
970229723 4:13897339-13897361 AAGCAAGCCAAGAGGAGCAAAGG + Intergenic
979337536 4:119480525-119480547 TCATAGGCTAAGAGGGGCAAAGG - Intergenic
1004027731 6:11835546-11835568 ACAGACCCCAAGAGTGGCAAGGG + Intergenic
1006694695 6:35921006-35921028 GCCTCCGCCACGAGGGGCAATGG - Intronic
1026963790 7:74426465-74426487 ACGGAGGCCCAGAGAGGCAAAGG + Intergenic
1027418692 7:77998875-77998897 ACAGAAGCAAAGAGGGGCAAGGG + Intergenic
1030231036 7:107208756-107208778 ACATACGCCCAGAGGGCCAGTGG + Intronic
1037990795 8:23320074-23320096 ACGGTCACCAAGAGGGACAAGGG + Intronic
1039120682 8:34142826-34142848 ACGCACTCCAAGCAGGGCAATGG + Intergenic
1051132731 9:13880818-13880840 AAGAAAGCAAAGAGGGGCAAGGG - Intergenic
1192315409 X:70047737-70047759 ACATAGGGCAAGTGGGGCAATGG - Intronic
1192724293 X:73731509-73731531 AGGGACTCCAAAAGGGGCAAGGG - Intergenic
1199976546 X:152897961-152897983 ACCTACCCCAGGAGGGGCAGAGG + Intergenic