ID: 1154173765

View in Genome Browser
Species Human (GRCh38)
Location 18:12068396-12068418
Sequence ACGTACGCCAAGAGGGGCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 35
Summary {0: 1, 1: 0, 2: 1, 3: 1, 4: 32}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154173765_1154173773 6 Left 1154173765 18:12068396-12068418 CCCTTGCCCCTCTTGGCGTACGT 0: 1
1: 0
2: 1
3: 1
4: 32
Right 1154173773 18:12068425-12068447 CCGCGCCGCCGCCGCCGCCGGGG No data
1154173765_1154173778 21 Left 1154173765 18:12068396-12068418 CCCTTGCCCCTCTTGGCGTACGT 0: 1
1: 0
2: 1
3: 1
4: 32
Right 1154173778 18:12068440-12068462 CGCCGGGGCCCACACCTGTCAGG No data
1154173765_1154173780 24 Left 1154173765 18:12068396-12068418 CCCTTGCCCCTCTTGGCGTACGT 0: 1
1: 0
2: 1
3: 1
4: 32
Right 1154173780 18:12068443-12068465 CGGGGCCCACACCTGTCAGGCGG No data
1154173765_1154173770 4 Left 1154173765 18:12068396-12068418 CCCTTGCCCCTCTTGGCGTACGT 0: 1
1: 0
2: 1
3: 1
4: 32
Right 1154173770 18:12068423-12068445 CTCCGCGCCGCCGCCGCCGCCGG No data
1154173765_1154173771 5 Left 1154173765 18:12068396-12068418 CCCTTGCCCCTCTTGGCGTACGT 0: 1
1: 0
2: 1
3: 1
4: 32
Right 1154173771 18:12068424-12068446 TCCGCGCCGCCGCCGCCGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154173765 Original CRISPR ACGTACGCCAAGAGGGGCAA GGG (reversed) Intergenic