ID: 1154173766

View in Genome Browser
Species Human (GRCh38)
Location 18:12068397-12068419
Sequence CACGTACGCCAAGAGGGGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 44}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154173766_1154173771 4 Left 1154173766 18:12068397-12068419 CCTTGCCCCTCTTGGCGTACGTG 0: 1
1: 0
2: 1
3: 6
4: 44
Right 1154173771 18:12068424-12068446 TCCGCGCCGCCGCCGCCGCCGGG No data
1154173766_1154173778 20 Left 1154173766 18:12068397-12068419 CCTTGCCCCTCTTGGCGTACGTG 0: 1
1: 0
2: 1
3: 6
4: 44
Right 1154173778 18:12068440-12068462 CGCCGGGGCCCACACCTGTCAGG No data
1154173766_1154173773 5 Left 1154173766 18:12068397-12068419 CCTTGCCCCTCTTGGCGTACGTG 0: 1
1: 0
2: 1
3: 6
4: 44
Right 1154173773 18:12068425-12068447 CCGCGCCGCCGCCGCCGCCGGGG No data
1154173766_1154173780 23 Left 1154173766 18:12068397-12068419 CCTTGCCCCTCTTGGCGTACGTG 0: 1
1: 0
2: 1
3: 6
4: 44
Right 1154173780 18:12068443-12068465 CGGGGCCCACACCTGTCAGGCGG No data
1154173766_1154173770 3 Left 1154173766 18:12068397-12068419 CCTTGCCCCTCTTGGCGTACGTG 0: 1
1: 0
2: 1
3: 6
4: 44
Right 1154173770 18:12068423-12068445 CTCCGCGCCGCCGCCGCCGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154173766 Original CRISPR CACGTACGCCAAGAGGGGCA AGG (reversed) Intergenic
904081680 1:27876389-27876411 CACCGATGCCAGGAGGGGCAAGG + Intronic
904476155 1:30765898-30765920 CACGGCAGCCAAGAGGGCCAAGG + Intergenic
906296352 1:44651294-44651316 CAGGTACCCCAAGAGGTGGATGG - Exonic
919807465 1:201388789-201388811 CACGTACCTCAAGAGTGGCAGGG - Intronic
920930866 1:210386680-210386702 CACGGAGGCCAAGAGGAGCGTGG - Intronic
1064261114 10:13787357-13787379 CCCGCACGCCCAGAGAGGCATGG + Intronic
1066254973 10:33670016-33670038 CATGCAAGCCCAGAGGGGCAGGG - Intergenic
1075777050 10:124995906-124995928 CACAGACGCCATGAGGGGGATGG - Intronic
1076411574 10:130255175-130255197 CACGTTCTCCAACAGGGACAAGG + Intergenic
1084657701 11:70528760-70528782 CACCTACGCCAAGTGGGGGAGGG + Intronic
1085322525 11:75583655-75583677 CCCCTACGCCGCGAGGGGCAGGG - Intergenic
1090214603 11:124950742-124950764 CACCTCCACCCAGAGGGGCAAGG - Intergenic
1103701741 12:122851711-122851733 CAGGGACCCCAGGAGGGGCAGGG - Intronic
1113957492 13:114107160-114107182 CACGTACCCCGTGAGGGTCAAGG - Intronic
1114690066 14:24573325-24573347 CACATATGGCAAAAGGGGCAAGG - Intergenic
1137581153 16:49634404-49634426 CACGGGAGCCAAGAGGGCCAGGG - Intronic
1138190106 16:55007738-55007760 CACAGACCCCAAGATGGGCATGG + Intergenic
1138514515 16:57528735-57528757 CGCGAGCGCCAAGAGGCGCAGGG - Exonic
1146896562 17:36545550-36545572 CACATTCGCCACGGGGGGCAGGG - Intronic
1147548926 17:41424377-41424399 CACGTTGGCCAAGAGGCACATGG + Exonic
1154173766 18:12068397-12068419 CACGTACGCCAAGAGGGGCAAGG - Intergenic
1158876747 18:61741418-61741440 CACGTAAGCCAAGAGGGTAGGGG + Intergenic
1163631406 19:18419648-18419670 CATGTACGCCAAGGGGGGCAAGG + Exonic
1165432937 19:35782677-35782699 CAGGTAAACCAGGAGGGGCAGGG + Exonic
926418448 2:12673973-12673995 CAGGTACCCCAACAGGGGAAGGG + Intergenic
927484442 2:23479033-23479055 CACGGAGGCCAAGAGGGGAGTGG - Intronic
928136722 2:28693459-28693481 CACGAAAGCCGAGAGGGACATGG + Intergenic
1173668900 20:44784057-44784079 CACTGACCCCAAGAGGGTCAAGG + Intronic
1174454092 20:50637420-50637442 CACGTTAGCCAAGGGGGTCAGGG - Intronic
1174472748 20:50772564-50772586 CACGTTAGCCAAGGGGGTCAGGG + Intergenic
1175926045 20:62472146-62472168 CACACAAGCCAAGAGGGGGATGG + Intronic
1176151108 20:63591380-63591402 CACAGACCCCAAGAGGAGCATGG + Intronic
954100420 3:48368070-48368092 CACTTCCTCCAAGGGGGGCAAGG - Intergenic
969369734 4:6724059-6724081 CACATACCCCAAGAGGGGCCTGG + Intergenic
972288955 4:37673271-37673293 CACTTAAGCCCAGAGGTGCAAGG - Intronic
977942032 4:102869222-102869244 CACGTTCGCCAAGCGGGGGAAGG + Intronic
987075716 5:14380195-14380217 CACGTAAGACAAGAGGGACACGG - Intronic
989188103 5:38644119-38644141 CCCCTAAGCCAAGAGGGGCCGGG + Intergenic
994804642 5:104428548-104428570 CACGTATGCCAAGGGGTGTAGGG + Intergenic
998121082 5:139578534-139578556 CACTTAAGCCCAGAGGGTCAAGG - Intronic
1001065602 5:168532816-168532838 CACTTGCGGCAGGAGGGGCAGGG - Intergenic
1014779624 6:125549136-125549158 CACGTTCCCCAAAATGGGCAGGG + Intergenic
1026777053 7:73236990-73237012 CACGAAGGCCACGAGTGGCAGGG + Intergenic
1027017899 7:74790360-74790382 CACGAAGGCCACGAGTGGCAGGG + Intergenic
1027070124 7:75155569-75155591 CACGAAGGCCACGAGTGGCAGGG - Intergenic
1027418691 7:77998874-77998896 CACAGAAGCAAAGAGGGGCAAGG + Intergenic
1037990794 8:23320073-23320095 CACGGTCACCAAGAGGGACAAGG + Intronic
1038975286 8:32688557-32688579 CACGTACTGCATGAGGGGCTGGG - Intronic
1049684817 8:143935032-143935054 CACGTCCGGCACGCGGGGCATGG + Exonic
1190384153 X:49868303-49868325 CACACAGGCCAAGAGGGGCAGGG + Intergenic
1192880146 X:75274638-75274660 CAAGTAAGCCAAGAGCGGAAGGG + Exonic
1198076987 X:133203360-133203382 CAGGTACTCCAAGAAGGGAAGGG + Intergenic