ID: 1154173767

View in Genome Browser
Species Human (GRCh38)
Location 18:12068402-12068424
Sequence AGCAGCACGTACGCCAAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 51}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154173767_1154173770 -2 Left 1154173767 18:12068402-12068424 CCCCTCTTGGCGTACGTGCTGCT 0: 1
1: 0
2: 1
3: 5
4: 51
Right 1154173770 18:12068423-12068445 CTCCGCGCCGCCGCCGCCGCCGG No data
1154173767_1154173778 15 Left 1154173767 18:12068402-12068424 CCCCTCTTGGCGTACGTGCTGCT 0: 1
1: 0
2: 1
3: 5
4: 51
Right 1154173778 18:12068440-12068462 CGCCGGGGCCCACACCTGTCAGG No data
1154173767_1154173771 -1 Left 1154173767 18:12068402-12068424 CCCCTCTTGGCGTACGTGCTGCT 0: 1
1: 0
2: 1
3: 5
4: 51
Right 1154173771 18:12068424-12068446 TCCGCGCCGCCGCCGCCGCCGGG No data
1154173767_1154173784 27 Left 1154173767 18:12068402-12068424 CCCCTCTTGGCGTACGTGCTGCT 0: 1
1: 0
2: 1
3: 5
4: 51
Right 1154173784 18:12068452-12068474 CACCTGTCAGGCGGCGCCGCGGG No data
1154173767_1154173773 0 Left 1154173767 18:12068402-12068424 CCCCTCTTGGCGTACGTGCTGCT 0: 1
1: 0
2: 1
3: 5
4: 51
Right 1154173773 18:12068425-12068447 CCGCGCCGCCGCCGCCGCCGGGG No data
1154173767_1154173783 26 Left 1154173767 18:12068402-12068424 CCCCTCTTGGCGTACGTGCTGCT 0: 1
1: 0
2: 1
3: 5
4: 51
Right 1154173783 18:12068451-12068473 ACACCTGTCAGGCGGCGCCGCGG No data
1154173767_1154173780 18 Left 1154173767 18:12068402-12068424 CCCCTCTTGGCGTACGTGCTGCT 0: 1
1: 0
2: 1
3: 5
4: 51
Right 1154173780 18:12068443-12068465 CGGGGCCCACACCTGTCAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154173767 Original CRISPR AGCAGCACGTACGCCAAGAG GGG (reversed) Intergenic