ID: 1154173767

View in Genome Browser
Species Human (GRCh38)
Location 18:12068402-12068424
Sequence AGCAGCACGTACGCCAAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 51}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154173767_1154173770 -2 Left 1154173767 18:12068402-12068424 CCCCTCTTGGCGTACGTGCTGCT 0: 1
1: 0
2: 1
3: 5
4: 51
Right 1154173770 18:12068423-12068445 CTCCGCGCCGCCGCCGCCGCCGG No data
1154173767_1154173784 27 Left 1154173767 18:12068402-12068424 CCCCTCTTGGCGTACGTGCTGCT 0: 1
1: 0
2: 1
3: 5
4: 51
Right 1154173784 18:12068452-12068474 CACCTGTCAGGCGGCGCCGCGGG No data
1154173767_1154173780 18 Left 1154173767 18:12068402-12068424 CCCCTCTTGGCGTACGTGCTGCT 0: 1
1: 0
2: 1
3: 5
4: 51
Right 1154173780 18:12068443-12068465 CGGGGCCCACACCTGTCAGGCGG No data
1154173767_1154173778 15 Left 1154173767 18:12068402-12068424 CCCCTCTTGGCGTACGTGCTGCT 0: 1
1: 0
2: 1
3: 5
4: 51
Right 1154173778 18:12068440-12068462 CGCCGGGGCCCACACCTGTCAGG No data
1154173767_1154173771 -1 Left 1154173767 18:12068402-12068424 CCCCTCTTGGCGTACGTGCTGCT 0: 1
1: 0
2: 1
3: 5
4: 51
Right 1154173771 18:12068424-12068446 TCCGCGCCGCCGCCGCCGCCGGG No data
1154173767_1154173783 26 Left 1154173767 18:12068402-12068424 CCCCTCTTGGCGTACGTGCTGCT 0: 1
1: 0
2: 1
3: 5
4: 51
Right 1154173783 18:12068451-12068473 ACACCTGTCAGGCGGCGCCGCGG No data
1154173767_1154173773 0 Left 1154173767 18:12068402-12068424 CCCCTCTTGGCGTACGTGCTGCT 0: 1
1: 0
2: 1
3: 5
4: 51
Right 1154173773 18:12068425-12068447 CCGCGCCGCCGCCGCCGCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154173767 Original CRISPR AGCAGCACGTACGCCAAGAG GGG (reversed) Intergenic
911420121 1:97630443-97630465 AGGAGCAGGCACCCCAAGAGGGG - Intronic
913521170 1:119647396-119647418 AGCAGCTCGCAGCCCAAGAGGGG - Intronic
915787990 1:158636671-158636693 AGAAGCACAAACGCCTAGAGGGG - Exonic
919958356 1:202440416-202440438 AGCAGCACCTCTGTCAAGAGAGG - Intronic
1064973030 10:21085329-21085351 AACAGCACGTAGGCCAAGTATGG + Intronic
1066573809 10:36803022-36803044 AGCAGCAGCTATGCCCAGAGCGG - Intergenic
1069496790 10:68911726-68911748 AGCAGCACATACGCTAAAATTGG - Intronic
1069659800 10:70116262-70116284 GGCAGCACGCCTGCCAAGAGAGG + Intronic
1071369884 10:84940465-84940487 AGCAGCACCTATGAGAAGAGAGG + Intergenic
1074152469 10:110769644-110769666 AGCTGCAAGTACACCAAGAATGG - Intronic
1075344603 10:121673044-121673066 AGAAGGACGTTCGGCAAGAGGGG + Intergenic
1080735425 11:35009248-35009270 AGCAGGAAGTACTCCAAGAAAGG - Intronic
1084629859 11:70340957-70340979 AGCAGCCCGTACTCTAGGAGAGG + Intronic
1084630463 11:70345054-70345076 AGCAGCCCGTACTCTAGGAGAGG + Intronic
1085346326 11:75770338-75770360 AGCAGCACCCACACCAAGAGGGG - Intronic
1088659208 11:112028837-112028859 AGCAGCACCTACCCCACAAGCGG + Exonic
1091744767 12:2984058-2984080 AGCAGCACCTCCACCAGGAGTGG + Intronic
1098963399 12:76762531-76762553 AGCAGCAGTTACTCAAAGAGGGG - Intergenic
1107537964 13:41354626-41354648 AGCAGCACGTATACCAAAATTGG - Intronic
1108268599 13:48736369-48736391 AGCAGCATGTATGCCCAGATTGG + Intergenic
1112104971 13:96230638-96230660 AGCAGTATGGAAGCCAAGAGAGG + Intronic
1127046596 15:55032496-55032518 AGCAGCACGTAAGGCAACAGGGG + Intergenic
1132231899 15:100190593-100190615 AGCAGGAGGAACCCCAAGAGGGG + Intronic
1141940489 16:87272881-87272903 AGAATCACCTACGCCCAGAGAGG + Intronic
1150280202 17:63925727-63925749 AGCAGCACCTGCAGCAAGAGGGG + Intergenic
1151948078 17:77330223-77330245 AGCAGCAGGTGCTCCAAGAGGGG - Intronic
1154173767 18:12068402-12068424 AGCAGCACGTACGCCAAGAGGGG - Intergenic
1160772910 19:841030-841052 AGCAGCACGGACGCCAGGGCAGG - Exonic
1163631405 19:18419643-18419665 AGCAGCATGTACGCCAAGGGGGG + Exonic
1164614890 19:29661376-29661398 AGCAGCATTTAGGCCAAGTGCGG + Intergenic
925256252 2:2491114-2491136 AGCAGCATGTACCTCAAGAAAGG + Intergenic
929010302 2:37435579-37435601 AGCAGCACGTACACTAAAATTGG - Intergenic
929659607 2:43770458-43770480 AGCAGCACGTTCAGAAAGAGCGG - Intergenic
930013624 2:46956222-46956244 AGAATCACGGAGGCCAAGAGTGG - Intronic
937097960 2:119247964-119247986 AGCAGCACGTAGGCCACGCACGG - Exonic
938035671 2:128032993-128033015 AGCAGCACCTATGCCAGGTGTGG + Intergenic
946375014 2:219302646-219302668 AGCAGCAGGTGCTCCAAGAGAGG + Exonic
947949315 2:234134150-234134172 AGCTGCACGTAACCCAGGAGGGG - Intergenic
1175926043 20:62472141-62472163 AGCGGCACACAAGCCAAGAGGGG + Intronic
1179162116 21:38907198-38907220 GGCAGCACGTGGGCCAAGAAAGG - Intergenic
1180236720 21:46465172-46465194 AGCAGCAAGAACTCCAAAAGAGG - Intronic
1183324846 22:37185624-37185646 AGCAGCAAGTTCCCCAAGATCGG + Intronic
1184261787 22:43321574-43321596 GGCTGCACGGACACCAAGAGTGG - Intronic
954958666 3:54545392-54545414 AACAGGAAGTACACCAAGAGTGG - Intronic
955139025 3:56250529-56250551 AGCAGTACGTACACCAAAACTGG + Intronic
962969147 3:140382750-140382772 AGCAGTCCGTAAGCCAGGAGAGG - Intronic
986011034 5:3715355-3715377 TGCAGCAAGAACGTCAAGAGCGG + Intergenic
989578269 5:43008716-43008738 ATCAGCACTTTCGCCAATAGCGG - Intergenic
1003673340 6:8180331-8180353 AGCAGCAAGTACCCCAGGAGAGG + Intergenic
1006911610 6:37566799-37566821 AGAGGGATGTACGCCAAGAGGGG - Intergenic
1007650482 6:43417351-43417373 AGGAGAAAGTAAGCCAAGAGGGG + Intergenic
1015447615 6:133325932-133325954 AGCAGAACGAACCCCAAGACGGG - Intronic
1025020236 7:55474796-55474818 AGCAGCACTGAGGCCAGGAGAGG + Intronic
1043926275 8:86040591-86040613 AGAAGAAGGTACACCAAGAGGGG + Intronic
1045533393 8:103004958-103004980 AGCATCACATAAGTCAAGAGAGG + Intergenic
1049567726 8:143350183-143350205 GGCAGCACATACGCTAAAAGTGG + Intronic
1055214924 9:73847793-73847815 AGCAGCAGGTATCCCAAGTGAGG - Intergenic
1186107786 X:6226243-6226265 AGCAGCACATACACAAAAAGAGG + Intronic