ID: 1154173768

View in Genome Browser
Species Human (GRCh38)
Location 18:12068403-12068425
Sequence GAGCAGCACGTACGCCAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 58
Summary {0: 1, 1: 0, 2: 2, 3: 4, 4: 51}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154173768_1154173778 14 Left 1154173768 18:12068403-12068425 CCCTCTTGGCGTACGTGCTGCTC 0: 1
1: 0
2: 2
3: 4
4: 51
Right 1154173778 18:12068440-12068462 CGCCGGGGCCCACACCTGTCAGG No data
1154173768_1154173780 17 Left 1154173768 18:12068403-12068425 CCCTCTTGGCGTACGTGCTGCTC 0: 1
1: 0
2: 2
3: 4
4: 51
Right 1154173780 18:12068443-12068465 CGGGGCCCACACCTGTCAGGCGG No data
1154173768_1154173770 -3 Left 1154173768 18:12068403-12068425 CCCTCTTGGCGTACGTGCTGCTC 0: 1
1: 0
2: 2
3: 4
4: 51
Right 1154173770 18:12068423-12068445 CTCCGCGCCGCCGCCGCCGCCGG No data
1154173768_1154173783 25 Left 1154173768 18:12068403-12068425 CCCTCTTGGCGTACGTGCTGCTC 0: 1
1: 0
2: 2
3: 4
4: 51
Right 1154173783 18:12068451-12068473 ACACCTGTCAGGCGGCGCCGCGG No data
1154173768_1154173771 -2 Left 1154173768 18:12068403-12068425 CCCTCTTGGCGTACGTGCTGCTC 0: 1
1: 0
2: 2
3: 4
4: 51
Right 1154173771 18:12068424-12068446 TCCGCGCCGCCGCCGCCGCCGGG No data
1154173768_1154173784 26 Left 1154173768 18:12068403-12068425 CCCTCTTGGCGTACGTGCTGCTC 0: 1
1: 0
2: 2
3: 4
4: 51
Right 1154173784 18:12068452-12068474 CACCTGTCAGGCGGCGCCGCGGG No data
1154173768_1154173773 -1 Left 1154173768 18:12068403-12068425 CCCTCTTGGCGTACGTGCTGCTC 0: 1
1: 0
2: 2
3: 4
4: 51
Right 1154173773 18:12068425-12068447 CCGCGCCGCCGCCGCCGCCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154173768 Original CRISPR GAGCAGCACGTACGCCAAGA GGG (reversed) Intergenic
908489354 1:64627526-64627548 GAGCATCATGAACTCCAAGAAGG - Intronic
1068422702 10:56817305-56817327 GAGCAGCACGATGGCAAAGAAGG - Intergenic
1075214683 10:120521807-120521829 GAGCAGCAGCTATGCCAAAATGG + Intronic
1075344602 10:121673043-121673065 GAGAAGGACGTTCGGCAAGAGGG + Intergenic
1075631214 10:124001673-124001695 GAGCAGGACGGCCGGCAAGATGG + Intergenic
1077170173 11:1162574-1162596 GAGCAGCAGCTACACCAAGGTGG + Exonic
1085346327 11:75770339-75770361 GAGCAGCACCCACACCAAGAGGG - Intronic
1098493098 12:71105085-71105107 GAGAAGCAAGTATTCCAAGAGGG - Intronic
1098963400 12:76762532-76762554 GAGCAGCAGTTACTCAAAGAGGG - Intergenic
1102463038 12:113112072-113112094 GAGCACCAGGTGCGCCAGGATGG - Exonic
1111561113 13:89948181-89948203 GAGCAGCTTGTAGGCCAAAAAGG + Intergenic
1117387344 14:55229198-55229220 GAGCAGCACCAAATCCAAGATGG + Intergenic
1127046595 15:55032495-55032517 TAGCAGCACGTAAGGCAACAGGG + Intergenic
1128767466 15:70259920-70259942 GAGCAGCACCAACCACAAGAGGG + Intergenic
1129033978 15:72638874-72638896 GATCAGCACGCTGGCCAAGATGG + Intergenic
1129215904 15:74098342-74098364 GATCAGCACGCTGGCCAAGATGG - Intergenic
1129733045 15:77942674-77942696 GATCAGCACGCTGGCCAAGATGG - Intergenic
1134243789 16:12524832-12524854 GAGCAGTACTTACACGAAGAAGG - Exonic
1140797467 16:78452969-78452991 GAGGATCACTTAGGCCAAGAAGG - Intronic
1147781950 17:42949695-42949717 CTGCAGCACTTACCCCAAGAAGG + Intergenic
1151948079 17:77330224-77330246 GAGCAGCAGGTGCTCCAAGAGGG - Intronic
1154173768 18:12068403-12068425 GAGCAGCACGTACGCCAAGAGGG - Intergenic
1162158982 19:8697991-8698013 GAGCAGCATCTCCGCCAGGAAGG + Exonic
1163631404 19:18419642-18419664 GAGCAGCATGTACGCCAAGGGGG + Exonic
934506180 2:94896583-94896605 AAGCAGTACGTAGACCAAGAGGG + Intergenic
937988808 2:127650962-127650984 GACCAGCACGCACGACAAGTCGG - Exonic
945458949 2:210082021-210082043 GAGCATCACTTGAGCCAAGAAGG - Intronic
1172951284 20:38724796-38724818 GAGCGGCATGTTCGCCAGGATGG + Exonic
1176160645 20:63646146-63646168 GAGCAGCACAGAGCCCAAGAGGG + Intronic
1176822833 21:13676017-13676039 GCGCAGCAGGAACGCCATGATGG - Intergenic
1177262517 21:18749299-18749321 GAGCAGCAGGAAGGCAAAGAGGG + Intergenic
1181256731 22:21567726-21567748 GAGCAGCACCAAATCCAAGATGG + Intronic
1184726875 22:46352165-46352187 GAGCAGCACGCACCTGAAGAAGG - Exonic
950433206 3:12963360-12963382 GAGCAGCTGGGACCCCAAGAAGG + Intronic
955704108 3:61710531-61710553 GGGCAGCATGTACCCCAGGATGG + Intronic
960959400 3:123058721-123058743 GAGCAGCCCGTCCTCCAGGAGGG - Intergenic
966730211 3:183144654-183144676 GCCCAGCTCGTAGGCCAAGAGGG + Intronic
967538057 3:190630258-190630280 GAGCAGCACTTCTGACAAGAAGG - Intronic
990321078 5:54630450-54630472 AAGCAGCACTTTCGCCAAGATGG - Intergenic
996542235 5:124642613-124642635 GAGCAGCACATCTGCCTAGATGG + Intronic
1006764728 6:36494842-36494864 GAACAGCACCTTAGCCAAGAGGG + Exonic
1008369882 6:50720051-50720073 GAGCAGCACACAAGGCAAGAGGG + Intronic
1015447616 6:133325933-133325955 CAGCAGAACGAACCCCAAGACGG - Intronic
1024583217 7:50817803-50817825 GAACAGCACAGAGGCCAAGAGGG - Intergenic
1033532576 7:142280057-142280079 GTGAAGCAAGTATGCCAAGAGGG + Intergenic
1035317520 7:158006092-158006114 GGGCAGCAGGTGCCCCAAGAAGG - Intronic
1038220586 8:25603364-25603386 GAGCAGCTCATAGGCCAAGGTGG + Intergenic
1056293526 9:85168440-85168462 GAGCAGCAAGTTAGCTAAGAAGG + Intergenic
1059448910 9:114357806-114357828 GAGCAGCAAGTATTCCAAGAAGG + Intronic
1062373364 9:136251648-136251670 GAGCAGCGCCTATGCCAGGAAGG - Intergenic
1062492750 9:136815163-136815185 GAACGGCAAGAACGCCAAGAAGG - Intronic
1186865870 X:13720339-13720361 TAGCAGCACGGACACCTAGAAGG + Intronic
1190442445 X:50488698-50488720 GTGCAGCACGCACACCAACATGG - Intergenic
1198278238 X:135117654-135117676 GGGCAGCAGGTAGGGCAAGAAGG - Intergenic
1198292724 X:135254862-135254884 GGGCAGCAGGTAGGGCAAGAAGG + Intronic
1198300743 X:135332117-135332139 GAGCAGCAGGTAGGCCAAGAAGG + Intronic
1198307896 X:135400622-135400644 AAGCAGCAGGTAGGGCAAGAAGG + Intergenic
1200108620 X:153727568-153727590 AAGTAGCACGTTGGCCAAGAGGG + Intronic