ID: 1154173769

View in Genome Browser
Species Human (GRCh38)
Location 18:12068404-12068426
Sequence GGAGCAGCACGTACGCCAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 1, 2: 0, 3: 1, 4: 54}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154173769_1154173784 25 Left 1154173769 18:12068404-12068426 CCTCTTGGCGTACGTGCTGCTCC 0: 1
1: 1
2: 0
3: 1
4: 54
Right 1154173784 18:12068452-12068474 CACCTGTCAGGCGGCGCCGCGGG No data
1154173769_1154173780 16 Left 1154173769 18:12068404-12068426 CCTCTTGGCGTACGTGCTGCTCC 0: 1
1: 1
2: 0
3: 1
4: 54
Right 1154173780 18:12068443-12068465 CGGGGCCCACACCTGTCAGGCGG No data
1154173769_1154173778 13 Left 1154173769 18:12068404-12068426 CCTCTTGGCGTACGTGCTGCTCC 0: 1
1: 1
2: 0
3: 1
4: 54
Right 1154173778 18:12068440-12068462 CGCCGGGGCCCACACCTGTCAGG No data
1154173769_1154173771 -3 Left 1154173769 18:12068404-12068426 CCTCTTGGCGTACGTGCTGCTCC 0: 1
1: 1
2: 0
3: 1
4: 54
Right 1154173771 18:12068424-12068446 TCCGCGCCGCCGCCGCCGCCGGG No data
1154173769_1154173773 -2 Left 1154173769 18:12068404-12068426 CCTCTTGGCGTACGTGCTGCTCC 0: 1
1: 1
2: 0
3: 1
4: 54
Right 1154173773 18:12068425-12068447 CCGCGCCGCCGCCGCCGCCGGGG No data
1154173769_1154173770 -4 Left 1154173769 18:12068404-12068426 CCTCTTGGCGTACGTGCTGCTCC 0: 1
1: 1
2: 0
3: 1
4: 54
Right 1154173770 18:12068423-12068445 CTCCGCGCCGCCGCCGCCGCCGG No data
1154173769_1154173783 24 Left 1154173769 18:12068404-12068426 CCTCTTGGCGTACGTGCTGCTCC 0: 1
1: 1
2: 0
3: 1
4: 54
Right 1154173783 18:12068451-12068473 ACACCTGTCAGGCGGCGCCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154173769 Original CRISPR GGAGCAGCACGTACGCCAAG AGG (reversed) Intergenic
900441290 1:2656722-2656744 GGAGCAGCACCCACACCAACAGG + Intronic
900442292 1:2661900-2661922 GGAGCAGCACCCACACCAACAGG + Intronic
900443185 1:2666516-2666538 GGAGCAGCACCCACACCAACAGG + Intronic
900444079 1:2671132-2671154 GGAGCAGCACCCACACCAACAGG + Intronic
900444982 1:2675788-2675810 GGAGCAGCACCCACACCAACAGG + Intronic
900445691 1:2679522-2679544 GGAGCAGCACCCACACCAACAGG + Intronic
900446003 1:2681168-2681190 GGAGCAGCACCCACGCCCACAGG + Intronic
900451481 1:2752154-2752176 GGAGCAGCACCCACACCAACAGG + Intronic
914438748 1:147682431-147682453 CCAGCAGCAAGTACGCCAACAGG + Intergenic
914667040 1:149840640-149840662 GGAGGAGCACGGAGGGCAAGCGG + Exonic
914668727 1:149853150-149853172 GGAGGAGCACGGAGGGCAAGCGG - Exonic
921633581 1:217464632-217464654 GGAGCAGAACAGAGGCCAAGGGG + Intronic
923439333 1:234000974-234000996 GGAGCAAGTCTTACGCCAAGAGG + Intronic
1064022021 10:11816719-11816741 GGAGGACCACCTAAGCCAAGGGG + Intergenic
1070154487 10:73825069-73825091 GGAGCAGCACTTCTGCCATGCGG + Intronic
1070385865 10:75923874-75923896 GGACCAGGATGTAGGCCAAGTGG + Intronic
1075344601 10:121673042-121673064 GGAGAAGGACGTTCGGCAAGAGG + Intergenic
1077256416 11:1585436-1585458 TGAGCAGCCCATACACCAAGGGG - Intergenic
1085346328 11:75770340-75770362 CGAGCAGCACCCACACCAAGAGG - Intronic
1087175306 11:95090218-95090240 GGAGCCGCAGGTAAGCGAAGTGG + Exonic
1090245522 11:125213546-125213568 GGAGAAGCACGTGAGCCTAGGGG - Intronic
1113869286 13:113548343-113548365 GGAGCAGCCAGTACATCAAGTGG + Exonic
1122276039 14:100591288-100591310 GCAGCAGCACGCACACCCAGTGG - Intergenic
1136117141 16:28101640-28101662 GGAGCAGCACGTTCACAAACTGG + Exonic
1141949791 16:87333124-87333146 GGAGCAGCCTGAACGGCAAGGGG + Intronic
1146383615 17:32349929-32349951 GGAGCCCCAGGTACGCTAAGGGG - Intronic
1151948080 17:77330225-77330247 GGAGCAGCAGGTGCTCCAAGAGG - Intronic
1154173769 18:12068404-12068426 GGAGCAGCACGTACGCCAAGAGG - Intergenic
1155802273 18:30122777-30122799 GGAGCAGCATGTATGCAGAGTGG - Intergenic
1158196026 18:54885904-54885926 GGAGCAGCAAGTGAGCAAAGGGG + Intronic
1159045693 18:63367073-63367095 GCAGCAGCACGAAGGCCACGAGG + Exonic
1163631403 19:18419641-18419663 GGAGCAGCATGTACGCCAAGGGG + Exonic
931855003 2:66293819-66293841 GGAGGATCACTTAAGCCAAGGGG + Intergenic
932895166 2:75632280-75632302 GGAGTAGCACTTATGCCAAATGG + Intergenic
941654648 2:168130167-168130189 AGAGCAGCAGGTACTGCAAGGGG + Intronic
942249333 2:174034204-174034226 GTAGCAGCACCTACCCCAAAGGG - Intergenic
1175674801 20:60937273-60937295 GGAGCAGCACTTGGGACAAGTGG - Intergenic
1179613868 21:42569384-42569406 GGAGCAGCAGGGAGGCCATGTGG - Intronic
1183328399 22:37206594-37206616 GCAGCAGCTCCTACCCCAAGAGG - Exonic
957371999 3:79306538-79306560 GGAGCCCCAGGTACGCTAAGGGG - Intronic
968083469 3:195863419-195863441 GGAGCAGCAACTTCGCCAACAGG + Exonic
968463545 4:737890-737912 GGAGCAGCACGTTGGCATAGCGG + Intronic
975836210 4:78424714-78424736 GGAGCATCACTTAAGCCCAGGGG + Intronic
994497793 5:100535566-100535588 GGAGGAGGACGGAAGCCAAGAGG - Exonic
1002055708 5:176596975-176596997 CGAGGAGCACGGCCGCCAAGGGG - Exonic
1006764727 6:36494841-36494863 GGAACAGCACCTTAGCCAAGAGG + Exonic
1025176039 7:56802970-56802992 GGTGCAGCACATCCTCCAAGTGG - Intergenic
1025695755 7:63773452-63773474 GGCGCAGCACATCCTCCAAGTGG + Intergenic
1026313906 7:69211586-69211608 GGAATAACACGGACGCCAAGGGG + Intergenic
1033532575 7:142280056-142280078 GGTGAAGCAAGTATGCCAAGAGG + Intergenic
1040464071 8:47678494-47678516 AGAGCAGCATGGAAGCCAAGGGG + Intronic
1049060641 8:140273622-140273644 GGAGCAGCAGGAATGCCGAGGGG - Intronic
1056028006 9:82520836-82520858 GGAGCAGCACGTATGACATTTGG + Intergenic
1057236199 9:93363432-93363454 GGTGCAGCAAGTAAGCCATGAGG + Intergenic
1203792543 EBV:159597-159619 GGAGCAGTACCTGCGCCAGGTGG - Intergenic
1195708636 X:107756909-107756931 GGGGCACCACGTGCTCCAAGGGG - Intronic
1200108619 X:153727567-153727589 GAAGTAGCACGTTGGCCAAGAGG + Intronic