ID: 1154173772

View in Genome Browser
Species Human (GRCh38)
Location 18:12068425-12068447
Sequence CCCCGGCGGCGGCGGCGGCG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2184
Summary {0: 2, 1: 18, 2: 190, 3: 476, 4: 1498}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154173772_1154173784 4 Left 1154173772 18:12068425-12068447 CCGCGCCGCCGCCGCCGCCGGGG 0: 2
1: 18
2: 190
3: 476
4: 1498
Right 1154173784 18:12068452-12068474 CACCTGTCAGGCGGCGCCGCGGG No data
1154173772_1154173783 3 Left 1154173772 18:12068425-12068447 CCGCGCCGCCGCCGCCGCCGGGG 0: 2
1: 18
2: 190
3: 476
4: 1498
Right 1154173783 18:12068451-12068473 ACACCTGTCAGGCGGCGCCGCGG No data
1154173772_1154173780 -5 Left 1154173772 18:12068425-12068447 CCGCGCCGCCGCCGCCGCCGGGG 0: 2
1: 18
2: 190
3: 476
4: 1498
Right 1154173780 18:12068443-12068465 CGGGGCCCACACCTGTCAGGCGG No data
1154173772_1154173778 -8 Left 1154173772 18:12068425-12068447 CCGCGCCGCCGCCGCCGCCGGGG 0: 2
1: 18
2: 190
3: 476
4: 1498
Right 1154173778 18:12068440-12068462 CGCCGGGGCCCACACCTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154173772 Original CRISPR CCCCGGCGGCGGCGGCGGCG CGG (reversed) Intergenic
Too many off-targets to display for this crispr