ID: 1154173778

View in Genome Browser
Species Human (GRCh38)
Location 18:12068440-12068462
Sequence CGCCGGGGCCCACACCTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154173769_1154173778 13 Left 1154173769 18:12068404-12068426 CCTCTTGGCGTACGTGCTGCTCC 0: 1
1: 1
2: 0
3: 1
4: 54
Right 1154173778 18:12068440-12068462 CGCCGGGGCCCACACCTGTCAGG No data
1154173768_1154173778 14 Left 1154173768 18:12068403-12068425 CCCTCTTGGCGTACGTGCTGCTC 0: 1
1: 0
2: 2
3: 4
4: 51
Right 1154173778 18:12068440-12068462 CGCCGGGGCCCACACCTGTCAGG No data
1154173766_1154173778 20 Left 1154173766 18:12068397-12068419 CCTTGCCCCTCTTGGCGTACGTG 0: 1
1: 0
2: 1
3: 6
4: 44
Right 1154173778 18:12068440-12068462 CGCCGGGGCCCACACCTGTCAGG No data
1154173767_1154173778 15 Left 1154173767 18:12068402-12068424 CCCCTCTTGGCGTACGTGCTGCT 0: 1
1: 0
2: 1
3: 5
4: 51
Right 1154173778 18:12068440-12068462 CGCCGGGGCCCACACCTGTCAGG No data
1154173764_1154173778 26 Left 1154173764 18:12068391-12068413 CCGAACCCTTGCCCCTCTTGGCG 0: 1
1: 1
2: 0
3: 7
4: 145
Right 1154173778 18:12068440-12068462 CGCCGGGGCCCACACCTGTCAGG No data
1154173772_1154173778 -8 Left 1154173772 18:12068425-12068447 CCGCGCCGCCGCCGCCGCCGGGG 0: 2
1: 18
2: 190
3: 476
4: 1498
Right 1154173778 18:12068440-12068462 CGCCGGGGCCCACACCTGTCAGG No data
1154173765_1154173778 21 Left 1154173765 18:12068396-12068418 CCCTTGCCCCTCTTGGCGTACGT 0: 1
1: 0
2: 1
3: 1
4: 32
Right 1154173778 18:12068440-12068462 CGCCGGGGCCCACACCTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154173778 Original CRISPR CGCCGGGGCCCACACCTGTC AGG Intergenic
No off target data available for this crispr