ID: 1154173784

View in Genome Browser
Species Human (GRCh38)
Location 18:12068452-12068474
Sequence CACCTGTCAGGCGGCGCCGC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154173769_1154173784 25 Left 1154173769 18:12068404-12068426 CCTCTTGGCGTACGTGCTGCTCC 0: 1
1: 1
2: 0
3: 1
4: 54
Right 1154173784 18:12068452-12068474 CACCTGTCAGGCGGCGCCGCGGG No data
1154173772_1154173784 4 Left 1154173772 18:12068425-12068447 CCGCGCCGCCGCCGCCGCCGGGG 0: 2
1: 18
2: 190
3: 476
4: 1498
Right 1154173784 18:12068452-12068474 CACCTGTCAGGCGGCGCCGCGGG No data
1154173767_1154173784 27 Left 1154173767 18:12068402-12068424 CCCCTCTTGGCGTACGTGCTGCT 0: 1
1: 0
2: 1
3: 5
4: 51
Right 1154173784 18:12068452-12068474 CACCTGTCAGGCGGCGCCGCGGG No data
1154173777_1154173784 -10 Left 1154173777 18:12068439-12068461 CCGCCGGGGCCCACACCTGTCAG No data
Right 1154173784 18:12068452-12068474 CACCTGTCAGGCGGCGCCGCGGG No data
1154173775_1154173784 -4 Left 1154173775 18:12068433-12068455 CCGCCGCCGCCGGGGCCCACACC No data
Right 1154173784 18:12068452-12068474 CACCTGTCAGGCGGCGCCGCGGG No data
1154173768_1154173784 26 Left 1154173768 18:12068403-12068425 CCCTCTTGGCGTACGTGCTGCTC 0: 1
1: 0
2: 2
3: 4
4: 51
Right 1154173784 18:12068452-12068474 CACCTGTCAGGCGGCGCCGCGGG No data
1154173774_1154173784 -1 Left 1154173774 18:12068430-12068452 CCGCCGCCGCCGCCGGGGCCCAC No data
Right 1154173784 18:12068452-12068474 CACCTGTCAGGCGGCGCCGCGGG No data
1154173776_1154173784 -7 Left 1154173776 18:12068436-12068458 CCGCCGCCGGGGCCCACACCTGT No data
Right 1154173784 18:12068452-12068474 CACCTGTCAGGCGGCGCCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154173784 Original CRISPR CACCTGTCAGGCGGCGCCGC GGG Intergenic
No off target data available for this crispr