ID: 1154177482

View in Genome Browser
Species Human (GRCh38)
Location 18:12094538-12094560
Sequence TGGGGGGCGTTGGATGTGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 2, 1: 0, 2: 1, 3: 7, 4: 139}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154177482 Original CRISPR TGGGGGGCGTTGGATGTGAT GGG Intronic
900120326 1:1046090-1046112 TGAGGGGTGTGGGATGTGAAGGG + Intronic
900613200 1:3553146-3553168 TGGGGGGCGGGGCTTGTGATGGG - Intronic
901672983 1:10866924-10866946 TGAGGGGCGGGGGATGTGATGGG - Intergenic
903680183 1:25091394-25091416 GGGGTGGCGTGGGATGTGGTTGG - Intergenic
912564501 1:110576753-110576775 TGGGTGGGGTGGGATGGGATGGG - Intergenic
912864313 1:113243744-113243766 TGGGAGGGGTAGGTTGTGATGGG - Intergenic
915505682 1:156354852-156354874 AGGGGGGCCTTGGATGGGAGGGG - Intronic
918177083 1:182056358-182056380 TCGGTGTCGTTGGAGGTGATTGG + Exonic
922279350 1:224108265-224108287 TGGGGGGTGTTGGGTGTGGTGGG - Intergenic
923104673 1:230844794-230844816 TGTGGGGCATAGGCTGTGATGGG - Intronic
924951744 1:248890853-248890875 TGGGGGGCTGTGGATGTGTGGGG - Intergenic
1062829337 10:595042-595064 TGCGGGTCGGTGGATGTGAACGG - Intronic
1066418864 10:35246132-35246154 TGGGGACCGGTGGAAGTGATTGG - Intergenic
1066633693 10:37480740-37480762 TGGGGGGTGGTGGTTCTGATGGG - Intergenic
1068305939 10:55208428-55208450 TGGGGGGAGGTGAATGTGAGAGG - Intronic
1070833408 10:79433720-79433742 TGGGGGGCCTTGTGTCTGATGGG + Intronic
1074322911 10:112420234-112420256 TGGGGGGTGTGGCCTGTGATAGG - Intronic
1075175677 10:120158523-120158545 TGGGGTACCTTGGAAGTGATAGG + Intergenic
1075397860 10:122140964-122140986 TGTGGGGCCTTGGATCTGAGGGG + Intronic
1080716517 11:34807382-34807404 TGGGGTGGGTTGGATGTGGATGG - Intergenic
1085250883 11:75143037-75143059 TGGGGGGCGGATGATGTGTTGGG + Intronic
1087769547 11:102192925-102192947 TGGGGGGTGTGGGAAGTGCTGGG + Intronic
1089383486 11:118052667-118052689 TGGGGGTCGTGGGATGTGGCTGG - Intergenic
1094626177 12:32126228-32126250 TGGGGGGAACTGGATGTGGTGGG + Intronic
1095997122 12:48097322-48097344 TGGGGGGAGGTGGATGTTACAGG + Intronic
1096469694 12:51868576-51868598 TGGGGGGCATTGGAGGAGTTCGG - Intergenic
1096791948 12:54051028-54051050 TGGCGGGGGTGGGATGTGACAGG + Intronic
1101349519 12:103915917-103915939 TGGGGGTCGGTGGCTGTGCTAGG - Intergenic
1101793107 12:107948666-107948688 AGGGGAGCGGTGGATGTAATTGG + Intergenic
1103216243 12:119203435-119203457 TAGAGGGAGTTGGAGGTGATGGG - Intronic
1103459321 12:121091034-121091056 TGGGGGGCGTTGGAAGGGCCTGG + Intergenic
1105488704 13:20864712-20864734 GGGTGGGTGTTGGATGTGAGGGG + Intronic
1105532989 13:21237076-21237098 AGAGTGGCGTTGAATGTGATAGG - Intergenic
1109024265 13:57140183-57140205 TGGGGGGGGGTGGCTGAGATAGG - Intergenic
1114297237 14:21340984-21341006 TTGGGAGAGTTGGATGTTATGGG + Intronic
1116466907 14:45244547-45244569 TGGGGGGAGTTGGATTTAACTGG - Intronic
1118730711 14:68664364-68664386 TGGGCGGGGGTGGATGTGGTGGG - Intronic
1119609595 14:76050404-76050426 TGGGAGGGTTTGGATGTGGTGGG + Intronic
1121129068 14:91428728-91428750 TTGGGGGATTTGGATGGGATAGG + Intergenic
1121328062 14:93033411-93033433 TGGGGGGCATTGGCTGTTGTGGG - Intronic
1122968918 14:105144545-105144567 TGGGGGGTGTCAGATGTGAATGG - Intronic
1123223886 14:106881815-106881837 TGGGTGTCGTTGGATGGAATGGG + Intergenic
1124042556 15:26118610-26118632 TCGGGGGTGTTGGCTGGGATTGG + Intergenic
1124165631 15:27323379-27323401 TGGCGGGCCCTGGATGTGCTTGG + Intronic
1130657252 15:85800330-85800352 TGGGGGGAGTGGGATTTGATTGG + Intergenic
1135359052 16:21795882-21795904 TGTGGGGCTTGGGAAGTGATTGG - Intergenic
1135457604 16:22612319-22612341 TGTGGGGCTTGGGAAGTGATTGG - Intergenic
1141243454 16:82284567-82284589 TGGGGGCAGTGGGGTGTGATGGG - Intergenic
1143523627 17:7460558-7460580 TGGGGGGAGGTGGGTGGGATGGG + Exonic
1143696219 17:8621437-8621459 TGGGGGGCTTTGGATCTGCATGG - Intronic
1143712902 17:8746030-8746052 TGGGGTGCGTGGGTTGTGGTGGG + Intergenic
1147609675 17:41794081-41794103 TGGGGGCCGTGGGATGGGACTGG - Intergenic
1150595955 17:66604867-66604889 GGGGGTGCGTTGCCTGTGATAGG + Intronic
1152630962 17:81410528-81410550 CCTGGGGCGTTGGATGTGACTGG + Intronic
1152962205 18:86649-86671 TGGGAGGCCTGGGAAGTGATGGG + Intergenic
1153932334 18:9889184-9889206 TGGAGGGAGTTGGATGAGTTTGG + Intronic
1154177427 18:12094392-12094414 TGGGGGGCGTTGGATGTGATGGG + Intronic
1154177482 18:12094538-12094560 TGGGGGGCGTTGGATGTGATGGG + Intronic
1154426721 18:14277849-14277871 TGGGGAGGGTTGGGGGTGATTGG + Intergenic
1154426742 18:14277907-14277929 TGGGGAGTGTTGGGGGTGATTGG + Intergenic
1154431739 18:14313789-14313811 TGGGGAGGGTTGGGGGTGATTGG + Intergenic
1155531626 18:26772624-26772646 TGGAGGGCCTTCCATGTGATGGG - Intergenic
1157544979 18:48540544-48540566 TGGGCGGCGTTGGCTCTGTTTGG + Intronic
1158724409 18:59956381-59956403 TAGTGGGCGGTGGATGTGGTGGG + Intergenic
1159963927 18:74577948-74577970 TGGGGAGCATTGGTAGTGATGGG + Intronic
1160394911 18:78564056-78564078 TGGGGGGTGTGGGAGGTGAGGGG - Intergenic
1161039087 19:2100556-2100578 TGGCGGGCGTTGGATGTCAGGGG - Intergenic
1161869243 19:6857541-6857563 TGAGGGGCTTTGTCTGTGATTGG - Intergenic
1162833393 19:13300759-13300781 TGGGGAGCCTTGGTTCTGATTGG - Intronic
1163009319 19:14414889-14414911 TGGGAGGCGGAGGTTGTGATGGG + Intronic
1164705019 19:30313577-30313599 TGGGAGGCTTTGGAGGTCATGGG - Intronic
1164800028 19:31068629-31068651 TGAGCGGAGTTGCATGTGATGGG + Intergenic
1166198511 19:41221479-41221501 TGGGGGTAGTTGGATGTCCTAGG + Intronic
927241487 2:20923296-20923318 TGGGGGGAGTTCGAGGTGCTTGG + Intergenic
927843142 2:26457803-26457825 TGGGGAGCCTTGGATGGGGTGGG - Exonic
929367622 2:41179218-41179240 GAGGGGGCGTTGAATTTGATCGG + Intergenic
932112622 2:69014306-69014328 TGGGGGGCGGGGGATGTTACTGG - Intronic
934933446 2:98446474-98446496 GGGGTGGCGTTGCATGTGAACGG + Intronic
937046849 2:118856233-118856255 CTGAGGGCGTTGGATGAGATTGG + Intergenic
937275883 2:120683854-120683876 TGGGGGGCGGGGCATGTGGTAGG - Intergenic
938677984 2:133658088-133658110 TGGGGGTCGTTGGGGGTGGTTGG - Intergenic
1169076084 20:2760521-2760543 TGGGGGCCGTGGGATGGGATTGG - Intergenic
1169805464 20:9554969-9554991 TGGGGAGTGATGGAAGTGATGGG - Intronic
1171245942 20:23609382-23609404 TGGGCTGCGTTGGATGGGAGAGG - Intergenic
1175726500 20:61322241-61322263 TGTGGGGAGTTGGAGGGGATGGG - Intronic
1184900222 22:47442128-47442150 TGGGGGGCCTGGGATGTTGTCGG - Intergenic
1185411281 22:50684232-50684254 TGCGGGGCCTTGGCTGAGATGGG + Intergenic
950265631 3:11570816-11570838 TGGGGTGCTTTGGATGAGCTCGG - Intronic
951543487 3:23805624-23805646 TGGGGGGCGCTGGGAGTGATTGG - Intergenic
951846642 3:27091662-27091684 TTAGGGGCCTTGGATGGGATGGG - Intergenic
952896007 3:38079503-38079525 TAGGGGGCTTTGGAGGCGATCGG + Intronic
953412631 3:42698856-42698878 TACGGGGCCTTGGCTGTGATGGG - Exonic
954128881 3:48549633-48549655 TGGTGGGGGTGGGAGGTGATGGG - Intronic
957991720 3:87635026-87635048 TGGGGGGAGTTGGAGGTGATTGG - Intergenic
961983356 3:131104578-131104600 TGGGGTGGGGTGGCTGTGATTGG + Intronic
962741042 3:138362690-138362712 GGGAGAGCGTTGGGTGTGATGGG - Intronic
969515327 4:7644611-7644633 TAGTGGCAGTTGGATGTGATTGG - Intronic
977586722 4:98782546-98782568 TGGGGCGCTTTGCATGTGAGGGG + Intergenic
984930012 4:184838739-184838761 TGGGGGGATTTGGAAGTGACTGG + Intergenic
987282083 5:16422493-16422515 TGGGGGGCTTCCGAGGTGATTGG - Intergenic
990389928 5:55308248-55308270 TGAGTGGCGTTGGAAGTGAAGGG + Intronic
991452057 5:66762444-66762466 TGGGGGGATTTGGAGTTGATGGG + Intronic
995009916 5:107245688-107245710 TGGGGGCCACTGGATGTGAACGG + Intergenic
997418854 5:133750454-133750476 TGGGGGGCCTGGGCTGTGATGGG - Intergenic
999970033 5:156850257-156850279 TGGGGGGTGGTGGGTGTGGTGGG - Intergenic
1000990469 5:167906717-167906739 TGGGGGGTGTTCAATGTGAATGG + Intronic
1001012810 5:168113932-168113954 GGGAGGGAGTTGGTTGTGATTGG - Intronic
1001329604 5:170752846-170752868 TGGCAGGGGGTGGATGTGATGGG - Intergenic
1004125831 6:12872690-12872712 CGGGGGGCATTTGATGTCATGGG - Intronic
1007581176 6:42960991-42961013 CCGGGGGCGTTGCATGAGATCGG + Intronic
1015639863 6:135319810-135319832 TTGAGGGTGTTAGATGTGATGGG + Intronic
1017994293 6:159518949-159518971 TGGGTGGCATTGCATGTGAGAGG + Intergenic
1018222863 6:161598795-161598817 TGGGTGGCCATGGATGTTATGGG + Intronic
1019188500 6:170235956-170235978 TGGGGGGCTGTGGCTGTGAATGG + Intergenic
1019476938 7:1248851-1248873 AGGCGGGCGTTGGATGTGGGTGG - Intergenic
1020261949 7:6535803-6535825 TGGGGGCTGTTGGATGCCATAGG + Intronic
1020871550 7:13636507-13636529 TGTTGGGGGTGGGATGTGATGGG + Intergenic
1022137872 7:27466355-27466377 TGGAGGGCCTTGGATGTGGGAGG + Intergenic
1022517842 7:30987207-30987229 TGGGGGGCCTTGGCTGAGAAAGG + Intronic
1022724260 7:32966429-32966451 AGGAGGGTGTTGGATGTGCTAGG + Intronic
1025049350 7:55721406-55721428 AGGAGGGTGTTGGATGTGCTAGG - Intergenic
1027764386 7:82321680-82321702 TGGGGGGCGTTGGGGATGGTAGG - Intronic
1033275780 7:139970864-139970886 AGGGTCCCGTTGGATGTGATAGG - Intronic
1039575331 8:38619144-38619166 GGGGGGGGGTGGGATGAGATGGG - Intergenic
1040862043 8:52008844-52008866 TTGGGGCCCTTGGAGGTGATTGG + Intergenic
1042893995 8:73645932-73645954 TGGGTGGGGTGGGAGGTGATTGG - Intronic
1049695530 8:143982719-143982741 TGGGGGCCTTGGGATCTGATAGG - Intronic
1051531912 9:18113347-18113369 TGGGGGAGGTTAGATGGGATTGG + Intergenic
1055589982 9:77802254-77802276 TGAGGGGGGTTGCATGGGATTGG - Intronic
1058625511 9:106929263-106929285 TGGGTGGCGTTTCATGTAATGGG - Exonic
1058923141 9:109637392-109637414 TGGGTTGCTTTGGATGTGACTGG + Intergenic
1058968593 9:110059591-110059613 TGTGGGGCTGTGGATGTGAAAGG + Intronic
1060216088 9:121739307-121739329 TGGGGGGCGTTGGGTGTTGCTGG + Intronic
1060272516 9:122156507-122156529 TGGTGTGCTTTCGATGTGATAGG - Intronic
1060795000 9:126507364-126507386 TGGGGGGAGTCGGAGGTGAAAGG - Intergenic
1061485752 9:130919760-130919782 TGGGGGACGTTGGCTGTGCCTGG + Intronic
1061569613 9:131469007-131469029 TGGGGTGCGGAGGAAGTGATGGG + Intronic
1062735935 9:138137468-138137490 TGGGAGGCCTGGGAAGTGATGGG - Intergenic
1194918640 X:99735521-99735543 TGGAGGGAGTAGGATGTGCTAGG + Intergenic
1195435246 X:104836272-104836294 TGGGGGGCTGTGGAGGAGATGGG + Intronic
1197682014 X:129395185-129395207 TGAGGGGGGTTGTATCTGATTGG - Intergenic
1198699723 X:139383500-139383522 TGGGGGTAGCTGGAAGTGATGGG + Intergenic
1199606321 X:149582497-149582519 TGGGAAGCGTTGAGTGTGATGGG - Exonic
1199632801 X:149786871-149786893 TGGGAAGCGTTGAGTGTGATGGG + Exonic
1199643659 X:149884945-149884967 TGGGAAGCGTTGAGTGTGATGGG + Exonic
1199875445 X:151924331-151924353 TGGGAGGAGCTGGGTGTGATGGG + Exonic
1199979205 X:152911734-152911756 TGGGATGGGATGGATGTGATGGG - Intergenic
1200398153 X:156003287-156003309 TGGGAGGCCTGGGAAGTGATGGG - Intronic
1201319983 Y:12687841-12687863 TGGGGGGAGTGGGATATGAAAGG + Intergenic