ID: 1154178202

View in Genome Browser
Species Human (GRCh38)
Location 18:12103176-12103198
Sequence CATCAGAGGGAGAGCAAGAA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 620
Summary {0: 1, 1: 0, 2: 12, 3: 58, 4: 549}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154178202 Original CRISPR CATCAGAGGGAGAGCAAGAA AGG Exonic
900802674 1:4747116-4747138 CATCAAAGGGAGAGAAGGAGAGG + Intronic
901201076 1:7467741-7467763 CAACAGAGAAGGAGCAAGAAGGG - Intronic
901270815 1:7952100-7952122 CATCAGAGGGAGACCGTGGAAGG - Intergenic
902018490 1:13327661-13327683 CATGAGAGGGAGAGGGAGACGGG - Intergenic
902503794 1:16926669-16926691 CTTCTCAGGGACAGCAAGAAGGG - Intronic
902606536 1:17572391-17572413 CAACAGAGGGACAGCAGGAAGGG - Intronic
902731044 1:18369035-18369057 CATCAGAGCAAGAGAAAGAAGGG + Intronic
903081191 1:20814806-20814828 CATCAGAGGGAGACCGTGGAAGG - Intronic
903638146 1:24834793-24834815 CATGAGAGGGAGAGGGAGACGGG + Intronic
903961943 1:27063469-27063491 CATCAGAGGGAGACCGTGGAGGG - Intergenic
904590535 1:31612837-31612859 CAGGAGTGGGAGAGGAAGAAGGG - Intergenic
904617066 1:31755637-31755659 CATTCTAGGCAGAGCAAGAAGGG - Intronic
904784943 1:32975812-32975834 CATCAGAGGGAGACCGTGGAAGG + Intergenic
905082880 1:35340353-35340375 CGTCAGAGGGAGAGGCAGGATGG + Intronic
905207922 1:36353456-36353478 CAGCAGAGGGACACCAAGCACGG - Intronic
905217258 1:36417591-36417613 CCTCAGAGGAAGAGTAAGCAAGG - Intronic
905776992 1:40674703-40674725 CATGAGAGGGACAGAGAGAAGGG - Intergenic
905793676 1:40803423-40803445 CAGCAGAGGGAGAAGCAGAAGGG - Intronic
906287550 1:44597446-44597468 CATGAGAGAGAGAGAGAGAAGGG - Intronic
906427034 1:45724005-45724027 CATCAGAGGGAGACCGTGGAAGG - Intronic
906762081 1:48384308-48384330 CATCAGAGGGAGACCGTGGAGGG + Intronic
906909425 1:49931476-49931498 CAGAAGAGAGAGAGCAAGACGGG + Intronic
907179340 1:52555427-52555449 CATCACAGCTAGAGCAAGTATGG + Intergenic
908370037 1:63472494-63472516 CATCAGAGGGAGACCATGGAAGG - Intronic
908445986 1:64200488-64200510 CATCAGAGGGAGACCGTGGAAGG - Intergenic
908699623 1:66884451-66884473 CATCAGATGCAGAAAAAGAAGGG - Intronic
909085460 1:71165505-71165527 CATCAGGGGCAGAGCAAGGCAGG - Intergenic
909183701 1:72457813-72457835 CATCAGAGAGAGAGAGAGGAAGG - Intergenic
909641302 1:77871058-77871080 CATCAGAGGGAGACCGTGGAAGG + Intronic
910117812 1:83751776-83751798 CCTCCTAGGGAGAGCTAGAAAGG - Intergenic
910441869 1:87261310-87261332 GAACAGAGGGAAGGCAAGAAAGG + Intergenic
910990774 1:93053643-93053665 AATTAGAGGAAGAGCAAGAGGGG - Intergenic
912751529 1:112292605-112292627 CATCAGAGGGAGACCGTGGAAGG - Intergenic
912763801 1:112390947-112390969 CATCAGAGGGACGGTCAGAAAGG + Intergenic
913148091 1:116011989-116012011 CAAAACAGGGAGGGCAAGAAAGG + Intronic
913319701 1:117579531-117579553 CCTCAGAGGCAGAGTAAGGAAGG - Intergenic
913393182 1:118337156-118337178 CATGTGTGGGAGAGAAAGAAAGG - Intergenic
913484767 1:119323965-119323987 CCTCAGACAGAGAGCAAGAGAGG - Intergenic
914887840 1:151599612-151599634 CATCAGAGGGAGACCGTGGAAGG - Intergenic
915021092 1:152778909-152778931 CATCAGAGAGCGAAGAAGAAGGG - Intronic
915116856 1:153606800-153606822 CCTCAAAGGCAGAGCAAGAAAGG - Intergenic
915732170 1:158061411-158061433 CAACACAGGGAGATCAAAAAGGG + Intronic
916125723 1:161569208-161569230 CATCAGAGGGACACCAGGAGGGG + Intergenic
916135639 1:161651039-161651061 CATCAGAGGGACACCAGGAGGGG + Intronic
916298793 1:163250209-163250231 CATTAGAGAGAGAGGAAGACTGG + Intronic
917646341 1:177032542-177032564 CTGCAGAGGGAGTGCATGAACGG - Exonic
918279687 1:182991957-182991979 CATCAGAGGCAGTGAAAGGATGG + Intergenic
918369275 1:183842457-183842479 CATGAGACGGAGAGGAAAAAGGG - Intronic
918421261 1:184366297-184366319 AATCAGAGGAAGAGCAAGGAAGG - Intergenic
919100786 1:193094860-193094882 CATCAGAGGTGGAGGAAAAATGG - Intergenic
919530220 1:198708361-198708383 AAACAGAGGGAGAACAAGAGAGG - Intronic
920053086 1:203175143-203175165 CACCAGCAGGAGAGCAAGAAAGG - Intronic
920596059 1:207271200-207271222 CAAAAGAGGGAAAGAAAGAAAGG - Intergenic
921031615 1:211339599-211339621 CAGAAGAGGGAGAGCAGGTAGGG - Intronic
921666226 1:217874987-217875009 TAAAAGAAGGAGAGCAAGAAAGG + Intergenic
922436781 1:225615004-225615026 CATCAGAGGGAGACCGTGGAGGG - Intronic
923263164 1:232286573-232286595 CATCATAGGGAAAACAAGAATGG + Intergenic
924803180 1:247342755-247342777 ACTCAGAGGGAAAGAAAGAAAGG - Intergenic
924943591 1:248829775-248829797 CATCAGAGGGAGACCGTGCAGGG - Intergenic
1062880254 10:972578-972600 CGTCAGAGTTAGACCAAGAAAGG + Intergenic
1063084831 10:2806952-2806974 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1063134865 10:3207781-3207803 CATCACAGGGAGAGAAACACAGG - Intergenic
1063485687 10:6418464-6418486 CATGAGAGGGGGAGAAAGCAGGG - Intergenic
1063715355 10:8521327-8521349 GATCAGAGGCAAAGCAAGAAGGG - Intergenic
1063877695 10:10497308-10497330 CAACAGAGGAAGAGAAACAAAGG + Intergenic
1064108823 10:12520901-12520923 CATCAGAGGGAGACCGTGGAAGG + Intronic
1065201063 10:23313627-23313649 CAGCAGAGAAAGAGCAAGAAGGG + Intronic
1065569305 10:27053347-27053369 CATCAGAAGAAGAGCAAGAAAGG - Exonic
1066007269 10:31157045-31157067 TTTCAGAGGCAGAGCAATAAGGG - Intergenic
1066083348 10:31954125-31954147 CAGGAGAGAGAGAGCATGAAGGG - Intergenic
1066085156 10:31969107-31969129 CATGAGAGGGAGAGGGAGACGGG - Intergenic
1066272537 10:33837549-33837571 CAGCAGAAGGGGAGCCAGAAAGG - Intergenic
1067029758 10:42872236-42872258 CCTCAGAGTGAGGACAAGAAGGG + Intergenic
1067729225 10:48797185-48797207 CATCAGAGTGAGAGCAGCCATGG + Intronic
1068139719 10:52990780-52990802 CATGAGGGAGGGAGCAAGAAAGG + Intergenic
1068538083 10:58262906-58262928 AAGCAGAGGGAGTGAAAGAATGG + Intronic
1068878438 10:62022697-62022719 CATTAGAGGGAGATCATCAAAGG + Intronic
1068969434 10:62947048-62947070 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1069481547 10:68787133-68787155 AAACAGAGGGAGAGGGAGAAGGG - Intronic
1069804891 10:71115774-71115796 GATGAGAGAGGGAGCAAGAACGG - Intergenic
1069848659 10:71390775-71390797 CATGAAAGGGGGAGCAGGAAGGG + Intergenic
1069962899 10:72088782-72088804 CAAAGGATGGAGAGCAAGAAGGG + Intronic
1070690213 10:78518797-78518819 CATCTGAGAGAGAGGATGAATGG + Intergenic
1072602565 10:96942415-96942437 CATCAGAGGGAGACCGTGGAAGG + Intronic
1073096633 10:100984006-100984028 CTTCTGAGGCAGAGCAACAATGG + Exonic
1074338746 10:112605362-112605384 CCTAAGAGGTAGAGGAAGAAAGG + Intronic
1076508283 10:130993419-130993441 CATCAGTGGGAGATGAAGAGGGG + Intergenic
1076827186 10:132974929-132974951 CTTCATAGGGACAGCAGGAAGGG + Intergenic
1077473809 11:2777095-2777117 CATCATGGGGAGAGCCAGGAGGG - Intronic
1077759913 11:5083419-5083441 TATCACAGGGACACCAAGAAGGG - Intergenic
1078176713 11:8977391-8977413 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1078324334 11:10367331-10367353 CATCAGGGGGATGGCAAGGAAGG - Intronic
1078584538 11:12571037-12571059 CAAGAGAGAGAGAGCACGAAGGG + Intergenic
1079321698 11:19456773-19456795 CACCAAAGGGAGAGCGAGAATGG - Intronic
1079573965 11:21980061-21980083 CAGGAGAGAGAGAGAAAGAAAGG + Intergenic
1080732895 11:34978780-34978802 TAACAGTGGGAGAGCATGAAGGG + Intronic
1080822566 11:35821383-35821405 CAAGAGAAGGATAGCAAGAAGGG - Intergenic
1081228532 11:40555500-40555522 CATCTGAGTGAGAGCAAGAAAGG - Intronic
1081292055 11:41338456-41338478 CATCTGAGGGAGAACATGAGGGG - Intronic
1081606274 11:44529049-44529071 CACCAGAAGGAGGGCAAGAGTGG - Intergenic
1081672017 11:44947716-44947738 CATCAGTGGTAGAGCCAGGATGG - Intronic
1082871168 11:57944618-57944640 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1083577245 11:63801075-63801097 AAAGAGAGGGAGAGAAAGAAAGG + Intergenic
1083592092 11:63901829-63901851 CACCAGAGGGAGAGCAGGGCAGG - Intronic
1084962699 11:72725662-72725684 AATCAGAGGGAGAGCAGGGAGGG - Intronic
1085120423 11:73964160-73964182 CATCAGGGGCAGAGCCAGGATGG + Intronic
1085480711 11:76820825-76820847 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1086263015 11:84963376-84963398 CATCAGAGAGAGAGCTGCAAGGG + Intronic
1086263408 11:84969233-84969255 CATCAGAGGCTGAGCAGCAAAGG - Intronic
1086570590 11:88279627-88279649 CATAAGAGGAAGAGCAAGATTGG - Intergenic
1087487148 11:98770727-98770749 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1088123221 11:106394113-106394135 CATCTCAGGGAGTGCAAGAAGGG - Intergenic
1088174460 11:107035542-107035564 CATAAGAATGAGAGCAAGAAGGG + Intergenic
1088654461 11:111986258-111986280 TATCAGGGCGAGATCAAGAAAGG - Intronic
1088976255 11:114818717-114818739 CATCAGAGGCAGAGCCTGAAAGG + Intergenic
1089145786 11:116328945-116328967 CATCAGAGGAATTGCTAGAACGG - Intergenic
1089326100 11:117658324-117658346 CATCAGACTGTGAGCTAGAAGGG - Intronic
1090072954 11:123560288-123560310 AGTCAGAGGGAGAGAGAGAAAGG + Intronic
1090073149 11:123561383-123561405 CAGCAGAAGGAGAGGATGAAAGG + Intronic
1090519175 11:127460386-127460408 GATCAGAGGCAGAGCCAGAATGG - Intergenic
1090624321 11:128592588-128592610 AAGCACAGGGAGAGAAAGAAAGG - Intergenic
1090907061 11:131085118-131085140 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1091170509 11:133516137-133516159 CCGCAGAGGGAGAGCAAGGCTGG + Intronic
1091378405 12:41281-41303 CATGAGAGGGAGAGGGAGACGGG - Intergenic
1091689590 12:2586727-2586749 CAGCGGAGGGAAAGCAAAAAGGG - Intronic
1092453373 12:8624380-8624402 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1092828026 12:12415522-12415544 CATCAGAGGGAGACCGTGGAAGG + Intronic
1093396801 12:18693037-18693059 CATTAGAAGAAAAGCAAGAAGGG + Intronic
1093919495 12:24844019-24844041 GACCAGAGGCAGAGGAAGAAGGG + Intronic
1094012786 12:25826818-25826840 CAGGAGAGTGAGAGCAAGATGGG - Intergenic
1094103084 12:26784374-26784396 CATCAGAGGGAGACCGTGGAAGG - Intronic
1094526537 12:31234740-31234762 CCGCAGAGTGAGAGCAACAAAGG + Intergenic
1094802919 12:34058589-34058611 CATGAAAGGCAGGGCAAGAAAGG - Intergenic
1095310945 12:40695779-40695801 GATAAGAGGGAGACAAAGAAAGG - Intronic
1095666958 12:44813862-44813884 CCTCACAGGAAGAGTAAGAAAGG + Intronic
1095859297 12:46897864-46897886 CAGGAGAGGGAGAGAGAGAAAGG - Intergenic
1096414373 12:51400974-51400996 CCTCACAGGGAGTGCAACAAGGG + Intronic
1097323711 12:58252576-58252598 TATGAGAGGGAGAAAAAGAAAGG - Intergenic
1098379700 12:69854317-69854339 CATCAGAGGGAGACCGTGGAGGG + Intronic
1098412435 12:70201154-70201176 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1100304493 12:93337947-93337969 CAACAGAGTGAGATCAAGATGGG + Intergenic
1100570924 12:95842348-95842370 CATGAGAGGGAGAGGGAGACGGG + Intergenic
1101887703 12:108681004-108681026 CAAGAGAGAGAGAGAAAGAAAGG - Intronic
1102136627 12:110581541-110581563 CATGAGAGGGAGACTTAGAAAGG - Intronic
1102658437 12:114503527-114503549 CAGGAGAGAGAGAGCCAGAAGGG - Intergenic
1102971576 12:117172018-117172040 CATGAGTGGGAGAGGAAGAGAGG - Intronic
1103551666 12:121742378-121742400 TATTAGAGGGAGAGCAAAAGGGG - Intronic
1104432381 12:128726958-128726980 CATGAGAGGGAGTGAAAGCAAGG - Intergenic
1105321647 13:19329568-19329590 CGTCAGAGCAAGAGCCAGAAAGG - Intergenic
1105388313 13:19953007-19953029 GATGAGAGTAAGAGCAAGAAGGG - Intergenic
1105900827 13:24751380-24751402 CTTCAAAGGAAGAACAAGAAAGG - Intergenic
1107043748 13:35974599-35974621 CAGGAGAGAGAGAGCAAGAGGGG - Intronic
1107412370 13:40169870-40169892 AAACAGAGGGAGAGAAAGACAGG - Intergenic
1107447802 13:40483894-40483916 CATCATAGGGAGACTAGGAAAGG - Intergenic
1107580384 13:41777451-41777473 CAACACAGTGAGAGAAAGAAGGG + Intronic
1109295845 13:60529896-60529918 CAGCCCAGTGAGAGCAAGAAAGG + Intronic
1110267472 13:73554742-73554764 CCTCAGTGAGAGAGCAAGAGGGG + Intergenic
1110505433 13:76280460-76280482 CAAAAGAGGGAGAGAAAGAGGGG + Intergenic
1110582884 13:77152727-77152749 CAGCAGAAGGGGAGCTAGAAAGG - Intronic
1111282222 13:86042034-86042056 CATCACAAGAACAGCAAGAAGGG - Intergenic
1111553551 13:89849424-89849446 CAGGAGAGAGAGAGCATGAAGGG + Intergenic
1111742829 13:92226094-92226116 CAGGAGAGAGAGAGCAAGAGGGG - Intronic
1111931631 13:94518681-94518703 CAACAGGAGGAAAGCAAGAATGG - Intergenic
1112201726 13:97283133-97283155 CATTAGAGGGAAAGTAGGAAGGG - Intronic
1113052521 13:106229807-106229829 CATCACAGCAAGAGCAAGAAGGG - Intergenic
1113391654 13:109903617-109903639 GAACAGAGAGAGAACAAGAATGG + Intergenic
1114057519 14:18985429-18985451 CATCAGAGGAAGAGTCACAAAGG + Exonic
1114105025 14:19416318-19416340 CATCAGAGGAAGAGTCACAAAGG - Exonic
1114198934 14:20505337-20505359 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1114427501 14:22636434-22636456 CATCAGAGGGAGACCCTGGAGGG - Intergenic
1115494127 14:33985515-33985537 CATCAGAGAGAAAGCAAGAAGGG + Intronic
1115703911 14:35978605-35978627 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1116273200 14:42798875-42798897 CATGAAAGTGAGGGCAAGAATGG - Intergenic
1116700802 14:48238988-48239010 CATAAAAGTGAGAACAAGAAAGG + Intergenic
1116982376 14:51185233-51185255 CAGGAGAGAGAGAGCAAGGAGGG + Intergenic
1117435030 14:55707899-55707921 CATCTGAGGCAGAGCCAGTAGGG + Intergenic
1118341418 14:64896653-64896675 CATGAGAGGGAGAGGGAGACGGG + Intergenic
1118483867 14:66195742-66195764 AATCAAAGGGTGAGCAAGACGGG + Intergenic
1118894868 14:69937417-69937439 CTCCTGAGGGAGAGAAAGAATGG - Intronic
1118968891 14:70614593-70614615 CATTTGAGAGAGAACAAGAAAGG + Intergenic
1120284445 14:82480490-82480512 GATAAGAGAGAAAGCAAGAAGGG - Intergenic
1120500554 14:85291979-85292001 AAGCAGACAGAGAGCAAGAAAGG + Intergenic
1120811711 14:88810574-88810596 AAGGAGAGGGAGAGGAAGAATGG - Intergenic
1121703000 14:95970415-95970437 CTTCAGAGGGAGTGGAGGAAAGG - Intergenic
1122568707 14:102678175-102678197 CATCAGAGGGAGACCGTGGAAGG + Intronic
1202830878 14_GL000009v2_random:28197-28219 CTTTAGAGGAAGAGCAAGAAAGG + Intergenic
1123497898 15:20848523-20848545 CATCAGAGGAAGAGTCACAAAGG - Exonic
1123555128 15:21422150-21422172 CATCAGAGGAAGAGTCACAAAGG - Exonic
1123591374 15:21859482-21859504 CATCAGAGGAAGAGTCACAAAGG - Intergenic
1123705803 15:22950390-22950412 CATCAGAGAGAGAGAAGGAAGGG + Intronic
1123907326 15:24933665-24933687 CATCAAAGGGATTGCCAGAAGGG + Intronic
1124111392 15:26792401-26792423 CATCAGAGGCAATGCAATAATGG - Intronic
1125065944 15:35486479-35486501 CAGCAGAGAGAAAGCAAGAAGGG + Intronic
1125868324 15:43075998-43076020 CATCAGAGGGAGACCATGGAAGG - Intronic
1125966800 15:43881247-43881269 CCTCAGAGGGATGGAAAGAAAGG + Intronic
1126295205 15:47131773-47131795 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1126453985 15:48841497-48841519 CAGCTGAGGCAGAGCCAGAAGGG - Intronic
1126557356 15:50004141-50004163 CAGCAGAGGGACAGGGAGAAGGG - Intronic
1126619902 15:50627858-50627880 CATCAGGGGGAATGCTAGAATGG + Intronic
1126824825 15:52538659-52538681 CAGGAGAGAGAGAGCAAGAAGGG - Intergenic
1127039828 15:54962514-54962536 CATCAAGAGGAGAGTAAGAATGG - Intergenic
1127228133 15:56957049-56957071 CAACAGACAGAGAGCAAGAGGGG - Intronic
1127584089 15:60365872-60365894 CATCAGAGGGAGACCGTGGAGGG - Intronic
1129176726 15:73845597-73845619 CCTAAGAGAGAGAGGAAGAACGG - Intergenic
1129343921 15:74904771-74904793 CATCAGGCGGAGAGCATGCAAGG + Intronic
1130025844 15:80269750-80269772 CAGCAGAGGGAGAGCTGGGATGG - Intergenic
1130127022 15:81102558-81102580 CTTCAGAGGCAGAGGTAGAAGGG + Intronic
1131159521 15:90095780-90095802 TAACAGAGAGAGAGCAAGCAGGG + Intronic
1202963475 15_KI270727v1_random:149360-149382 CATCAGAGGAAGAGTCACAAAGG - Intergenic
1132891474 16:2206940-2206962 CAGCAGAGGGAGGGGAGGAATGG + Intronic
1133932710 16:10245168-10245190 CCTCAGAGGCAGAGCAAGCAGGG - Intergenic
1134012753 16:10867407-10867429 AGACAGAGGGAGAGCGAGAAAGG + Intergenic
1134044784 16:11093201-11093223 CAGCAGAGTGAGAGAGAGAAGGG + Intronic
1134286262 16:12864591-12864613 CATCAGAGAAAGAGGAAGAAGGG - Intergenic
1135043421 16:19135459-19135481 AATCAGAAGGAGAGAAAGCAGGG + Intronic
1136571961 16:31103654-31103676 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1137555185 16:49465746-49465768 CATCAGAGAGAGAGGAGCAAGGG + Intergenic
1137897718 16:52232307-52232329 CAAAAGGGGGAGAGGAAGAAAGG + Intergenic
1138073200 16:54014414-54014436 CATCACACGGAGAGAGAGAAAGG - Intronic
1138093693 16:54195914-54195936 CAAGAGAGGCAGAGCAAGAGGGG + Intergenic
1138640698 16:58383886-58383908 CTTCACAGGGAGCCCAAGAAGGG - Intronic
1138766810 16:59614812-59614834 AATGTGAAGGAGAGCAAGAATGG + Intergenic
1139443320 16:66979875-66979897 CATCTGAGGGAGAGCAGGGCTGG - Intergenic
1139556166 16:67712309-67712331 CATCAGAGGGAGACCGTGGAGGG - Intronic
1139639820 16:68283113-68283135 CATCAGAAAGAGAGTATGAAAGG + Intronic
1139864026 16:70050350-70050372 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1141376596 16:83536447-83536469 CATCACAGGGAGAGAGAAAAGGG + Intronic
1142496047 17:306856-306878 CATGAGAAGGAGAGGAAGAGAGG - Intronic
1142635562 17:1255226-1255248 CAAAAGAAGGAGAGGAAGAATGG - Intergenic
1142818397 17:2446633-2446655 CATCAGAGGGAGACCGTGGAAGG - Intronic
1144717855 17:17446801-17446823 GATCAGTGTGAGAGGAAGAAAGG - Intergenic
1144793670 17:17876728-17876750 CATCAGTGGGAGGGCAAGGATGG + Intronic
1145733480 17:27211414-27211436 CATGAGAGGGAGAGGGAGACGGG - Intergenic
1146054457 17:29574216-29574238 CATTAAAGGGAGAGCAGCAAGGG + Exonic
1146216591 17:30981332-30981354 CATCAGAGGGAGACCGTGGAGGG + Intronic
1146444673 17:32923793-32923815 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1147383926 17:40070986-40071008 CAGTAGAGGGAGAGGAAGAAAGG - Intronic
1147500396 17:40957758-40957780 CTTCACAGGGAGGGGAAGAAGGG + Intergenic
1148555055 17:48573641-48573663 GGTCAGAGGGAGAGAAAGAGGGG - Intronic
1149413961 17:56438900-56438922 CATCAAAGGGAGAAGGAGAAGGG + Intronic
1149503277 17:57171415-57171437 CATCAGACAGACAGCAAGGATGG - Intergenic
1149533935 17:57417401-57417423 CATCAGCTGCAGAGCAAGGAGGG + Intronic
1151889061 17:76941529-76941551 CATCTGAGCTATAGCAAGAAGGG - Intronic
1152019940 17:77775688-77775710 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1152242366 17:79167319-79167341 CCCCAGAGGGAGGGGAAGAAGGG - Intronic
1152396826 17:80038146-80038168 CTTCTGAGGGAGAGAAGGAAGGG + Exonic
1154178202 18:12103176-12103198 CATCAGAGGGAGAGCAAGAAAGG + Exonic
1154334758 18:13456467-13456489 CATCATAGAAAGAGAAAGAAAGG - Intronic
1154455893 18:14524943-14524965 CATCAGAGGAAGAGTCACAAAGG - Exonic
1157221185 18:45829392-45829414 CAGCAGAGAAAGGGCAAGAATGG - Intronic
1157543162 18:48526747-48526769 CAGCAGAAGGAGAGGGAGAAGGG - Intergenic
1158547880 18:58411304-58411326 TATGAGAGGCAGAGCAAAAAAGG - Intergenic
1159009982 18:63049937-63049959 CACCAGAGAGAAAGCAAGCAAGG - Intergenic
1159129041 18:64258999-64259021 CAACAGAGAGTGAGAAAGAAGGG + Intergenic
1159280400 18:66277969-66277991 CATCAGATAAAGAGCAATAATGG + Intergenic
1159313815 18:66744417-66744439 GATCAGAGTGAGAGGAGGAAGGG - Intergenic
1159441565 18:68486731-68486753 CATCAGAAGGAGAGCAAGCTGGG - Intergenic
1159672523 18:71239346-71239368 CACCAGAGGGAGAGCCAGGCAGG + Intergenic
1161696577 19:5772021-5772043 AAACAGAGAGAGAGAAAGAAAGG - Intronic
1162340240 19:10087335-10087357 CACGGGAGGGAGAGCAAGAGGGG + Intronic
1162683083 19:12361743-12361765 CATCAGAGGGAGACCGTGGAGGG - Intronic
1162860167 19:13500393-13500415 CACTAGAGAGAGAGAAAGAAGGG - Intronic
1162934677 19:13975857-13975879 ACTCAGAGGGAGAGACAGAAGGG + Intronic
1164066272 19:21720372-21720394 CATGAGAGGGAGAGGGAGACGGG - Intergenic
1166163267 19:40967413-40967435 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1167191342 19:47991935-47991957 GAGCAGAGTGAGAGCAAGGAAGG - Intronic
1167238162 19:48327329-48327351 CATCGGAGGTAGAGCTAAAAGGG - Intronic
1167251634 19:48401558-48401580 TATTTGAGGAAGAGCAAGAAGGG + Intronic
1167588871 19:50391669-50391691 CATCAGAGGGAGACTGAGAGGGG + Intronic
1167647384 19:50713086-50713108 CATCTGAGGGAGAGAAGGGAGGG + Intronic
1167693184 19:50999892-50999914 CCCCAGAGGGAGACAAAGAAGGG - Intronic
1167937282 19:52919191-52919213 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1167971224 19:53188554-53188576 CATCAGAGGGAGACCGTGGAGGG + Intronic
1168220357 19:54956118-54956140 CAACAGAGGGAGAGAAAGGAAGG + Intronic
1202641814 1_KI270706v1_random:99579-99601 CTTTAGAGGAAGAGCAAGAAAGG - Intergenic
924960350 2:29123-29145 CGACAGAGAGAGAGAAAGAAAGG - Intergenic
925403798 2:3592220-3592242 CATCAGAGGGAGACCGTGGAAGG + Intergenic
925641420 2:5989193-5989215 GATCAGAAGTAGAGCAAGCAAGG - Intergenic
925820441 2:7794561-7794583 CTTCAGAGGGACAGAAAGACAGG + Intergenic
926129721 2:10295185-10295207 CATCAGAAGCAGAGCTGGAAAGG + Intergenic
927302700 2:21534853-21534875 CAGGAGAGAGAGAGCATGAAGGG - Intergenic
927680132 2:25133452-25133474 CTGCAGAGGAAGAGCAGGAATGG - Intronic
928003399 2:27541367-27541389 CATCAGAGGGAGACCGTGGAAGG + Intronic
928005612 2:27558873-27558895 CATCAGAGGGAGACCGTGGAGGG + Intronic
928289190 2:30022802-30022824 GAGCAGAGGAAGAGAAAGAAGGG - Intergenic
928466500 2:31527655-31527677 CACCAGAGGCAGAGCGGGAATGG - Intronic
928542368 2:32295039-32295061 CATCAGAGGGAGAGGGGGAGGGG + Intronic
928558278 2:32448623-32448645 CATCAGAGGGAGACCGTGGAAGG + Intronic
929739360 2:44587499-44587521 CATCAGAGGGAGACCGTGGAAGG - Intronic
930902195 2:56521235-56521257 CAAGAGAGGGAGAGAAACAAGGG - Intergenic
931125242 2:59268726-59268748 CCTCAAAGGGAGAGGAAGAGGGG - Intergenic
931178850 2:59879848-59879870 AATGAGAGGGAGAGCGGGAAGGG + Intergenic
931697025 2:64879023-64879045 CACCAGAGGCAGAGCATGGAAGG + Intergenic
932061343 2:68502026-68502048 CATGAGAGAGTGAGCAAGAGAGG + Intronic
932293657 2:70606604-70606626 CTTCAGATGGGGAGCAGGAAAGG + Intergenic
933183530 2:79253638-79253660 AAACAGAGGGACAGCAAGGAAGG + Intronic
934115845 2:88792442-88792464 CATCAGAGGGAGAGCAAAAGAGG + Intergenic
934497651 2:94823034-94823056 CTTCAGAGGAAGAGCAAGAAAGG - Intergenic
934627745 2:95876469-95876491 CATCAGAGGGAGAGCAAAAGAGG - Exonic
934805821 2:97224827-97224849 CATCAGAGGGAGAGCAAAAGAGG + Exonic
934831699 2:97532341-97532363 CATCAGAGGGAGAGCAAAAGAGG - Exonic
935083569 2:99823042-99823064 AACCAGAGGGAAAGCATGAAGGG - Intronic
935346303 2:102111665-102111687 AATGAGAAGGAGAGCAGGAAGGG + Intronic
935630991 2:105211888-105211910 CATCAGAGGGAGACCGTGGAAGG + Intergenic
935839973 2:107098488-107098510 GAGCAGATGGAGAGCAAGAAGGG - Intergenic
937583162 2:123513897-123513919 CATCAGAGGAAGAGGCAGTATGG - Intergenic
937760808 2:125601350-125601372 CATCAAAGTAAGAGCAGGAAAGG - Intergenic
937858551 2:126690466-126690488 CCTCTGAGGGAGAGAAAAAATGG - Intronic
937859055 2:126694051-126694073 CCTCTGAGGGAGAGAAAAAATGG - Intronic
938283641 2:130088097-130088119 CATCAGAGGAAGAGTCACAAAGG - Exonic
938284727 2:130102140-130102162 CATCAGAGGAAGAGTCACAAAGG - Exonic
938334276 2:130476661-130476683 CATCAGAGGAAGAGTCACAAAGG - Exonic
938335368 2:130490700-130490722 CATCAGAGGAAGAGTCACAAAGG - Exonic
938354455 2:130629967-130629989 CATCAGAGGAAGAGTCACAAAGG + Exonic
938355549 2:130644001-130644023 CATCAGAGGAAGAGTCACAAAGG + Exonic
938430877 2:131236750-131236772 CATCAGAGGAAGAGTCACAAAGG + Exonic
938431966 2:131250796-131250818 CATCAGAGGAAGAGTCACAAAGG + Exonic
938533632 2:132220387-132220409 CATCAGAGGGAGACCGTGGAAGG - Intronic
938657092 2:133445708-133445730 CAGCACAGGGAGAGTAAGGAAGG + Intronic
940643095 2:156367584-156367606 CATCAGAGGGAGACCGTGGAGGG - Intergenic
942156706 2:173136508-173136530 AAGCAGAGGGTGAGAAAGAAAGG + Intronic
942192046 2:173479954-173479976 CATGAGAAGGAGAGCAAGCTGGG + Intergenic
942360649 2:175168276-175168298 CCTCAGAAGGAAGGCAAGAAGGG - Intronic
942543955 2:177043569-177043591 AAGGAGAGGGAGAGGAAGAAAGG - Intergenic
943740185 2:191399238-191399260 CATCAGAGGGAGACCGTGGAAGG + Intronic
944599042 2:201284649-201284671 CATGAGAGGGAGAGGGAGACGGG + Intronic
945120929 2:206456236-206456258 CAGGAGAGAGAGAGCAAGCAAGG + Intronic
945232781 2:207609821-207609843 CATCAGAGGGAGACCGTGGAGGG - Exonic
945407688 2:209469594-209469616 GTGCAGAGGGAGAGTAAGAAAGG - Intronic
945835983 2:214836327-214836349 CATCAGAGGGAGACCGTGGAGGG + Intergenic
945970609 2:216227528-216227550 CATGAGAGGGAGAGGGAGACGGG + Intergenic
946543852 2:220715424-220715446 CAGGAGAGAGAGAACAAGAAGGG + Intergenic
947422885 2:229956533-229956555 GATTTGAGGGAGAGAAAGAATGG + Intronic
947740055 2:232480892-232480914 CTTCACAGGGAGAGCAGGGAGGG - Intronic
947973927 2:234347713-234347735 CATCAAAGACAGAGGAAGAATGG + Intergenic
948000288 2:234562189-234562211 CATCAGGGGGAGACCATGGAAGG - Intergenic
1169085497 20:2823089-2823111 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1170902599 20:20480461-20480483 CATCATAGGGATAGGAAAAAAGG - Intronic
1171275736 20:23855462-23855484 CATCAGAGTGGGGGCAAGCATGG + Intergenic
1171888937 20:30689779-30689801 CTTCAGAGGAAGAGAAAGGAAGG - Intergenic
1172134309 20:32676694-32676716 CAGCAGAGGGAGTGCAGGCATGG + Intergenic
1173381959 20:42553435-42553457 CATGAGAGGAAAAGCAAAAATGG - Intronic
1174441796 20:50561476-50561498 CAGCAAAGGAAGAGCAAGACTGG - Intronic
1174732873 20:52935296-52935318 TATCAGATGGAAAGCAAGACAGG - Intergenic
1175559104 20:59903718-59903740 CATCATAGTGAAAGCAAAAAAGG + Intronic
1176610065 21:8873035-8873057 CTTTAGAGGAAGAGCAAGAAAGG + Intergenic
1176788460 21:13289124-13289146 CATGAGAGGAAGGGCAAGAGTGG - Intergenic
1176818270 21:13628400-13628422 CATCAGAGGAAGAGTCACAAAGG + Exonic
1176853711 21:13945069-13945091 CTTCAGAGGAAGAGCAACAAAGG - Intergenic
1177547056 21:22572342-22572364 CATAAGAGTCAAAGCAAGAATGG + Intergenic
1177648115 21:23925682-23925704 CATCAGAGGGAATGCCTGAAGGG + Intergenic
1177987614 21:27997329-27997351 CATGAGAGGTAGGGCAAGAGTGG - Intergenic
1178109693 21:29357739-29357761 CATCACAGAGAGAGCAAGGATGG - Intronic
1180017212 21:45095269-45095291 CATCACACGCAGAGCAAGCAGGG - Intronic
1180360128 22:11882286-11882308 CTTTAGAGGAAGAGCAAGAAAGG + Intergenic
1180476009 22:15708038-15708060 CATCAGAGGAAGAGTCACAAAGG + Exonic
1181499771 22:23309262-23309284 CAACAGAGGTAGAGTAAGGAGGG - Intronic
1181585944 22:23853838-23853860 CATCAGAGGGAGACCGTGGAGGG - Intergenic
1181993485 22:26856514-26856536 CATCATAGTGACATCAAGAATGG - Intergenic
1182164021 22:28154005-28154027 CATCAGAGAGAGAGAGAGAGAGG + Intronic
1182538722 22:31026313-31026335 CATCAGAGGGAGACCGTGGAAGG - Intergenic
1182661157 22:31926171-31926193 CAACAGAGAGAAAGCCAGAAGGG + Intergenic
1183871892 22:40746367-40746389 CATGAGAGGGAGAGGGAGACGGG + Intergenic
1184201197 22:42971109-42971131 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184202453 22:42980510-42980532 CATCAGAGGGAGACCGTGGAGGG - Intronic
1184974712 22:48052806-48052828 CAGCGGAGGGAAAGCAAGATGGG - Intergenic
949787171 3:7754654-7754676 CATCAAAGGGAGAGCAAAGCAGG - Intergenic
950698741 3:14725387-14725409 CATCAGAGAGACAGGCAGAATGG + Intronic
951443219 3:22746847-22746869 CATCAGAAGGATAGCCAGAGAGG - Intergenic
952737465 3:36704774-36704796 CCTCAGAGGGACAGCAAGACTGG + Intergenic
952753371 3:36843823-36843845 CAGCAGAGGGCGAGCAGGGAGGG - Intronic
953137305 3:40192259-40192281 AATCAGAGGGAGAATTAGAAAGG - Intronic
953582521 3:44169833-44169855 AATCAGAGGTAGAGCCAGGACGG + Intergenic
953774569 3:45804185-45804207 CAAGAGAGAGAGAGGAAGAAGGG - Intergenic
953832187 3:46309462-46309484 TATCAGATGAAGAGAAAGAAAGG - Intergenic
954399787 3:50312948-50312970 CATCAGAGGGAGACCGTGGAGGG + Intergenic
954619692 3:51988504-51988526 CTTCTGAGGGACAGGAAGAATGG - Exonic
956643159 3:71433508-71433530 CATCAGAGAGAGGGCAGGCAGGG + Intronic
956947492 3:74239498-74239520 TAGCTCAGGGAGAGCAAGAATGG + Intergenic
958506725 3:94988465-94988487 GGGCAGAGGGAAAGCAAGAAAGG - Intergenic
959355928 3:105328406-105328428 TCCCAGAGGGAAAGCAAGAAAGG + Intergenic
959415920 3:106075761-106075783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
960427232 3:117523706-117523728 CATCAGAGAGAAAGGAAGAAAGG + Intergenic
960780797 3:121314567-121314589 CATCAGAGGGAGACCGTGGAGGG + Intronic
960822292 3:121748049-121748071 AATCAAAGGGAGAAAAAGAAAGG + Intronic
961744006 3:129052040-129052062 GATCTGATGGAGAGCAAGGAGGG - Intergenic
962422642 3:135241706-135241728 CGTCAGAGGCAGAGCAGGATGGG - Intronic
962732025 3:138292385-138292407 CATCTGTAGGAGGGCAAGAATGG + Intronic
962756397 3:138468288-138468310 CTTCAGGAGGTGAGCAAGAAGGG - Intronic
963280912 3:143384116-143384138 CATCTGAGGAGGAACAAGAAGGG + Intronic
963380613 3:144525162-144525184 AATAAGAAAGAGAGCAAGAAAGG + Intergenic
963911782 3:150821809-150821831 CATCAGAGGGAGACCGTGGACGG + Intergenic
964373943 3:156031223-156031245 AAAGAGAGGGAGAGCAGGAAAGG + Intergenic
965494718 3:169383779-169383801 AATCAGATGGAAAGGAAGAATGG - Intronic
965900869 3:173639898-173639920 GATGAAAGAGAGAGCAAGAAAGG - Intronic
966783686 3:183607362-183607384 CATCAGAGGGAGACCGTGGAAGG - Intergenic
967573778 3:191065494-191065516 CAGGAGAGGGATAGCAAGAGAGG - Intergenic
1202736748 3_GL000221v1_random:7819-7841 CTTTAGAGGAAGAGCAAGAAAGG + Intergenic
968506991 4:975366-975388 CATCAGAGGGAGACCGTGGAAGG - Intronic
968636432 4:1683286-1683308 CATCAGAGTGGGTGCTAGAAGGG - Intronic
968789764 4:2651490-2651512 CAGGAGAGAGAGAGCAAGAGGGG + Intronic
969094540 4:4722323-4722345 AAAGAGAGGGAGAGGAAGAAAGG - Intergenic
970225432 4:13852049-13852071 AATGAGAGGGAGAGAAGGAAAGG + Intergenic
970234438 4:13944483-13944505 CAGCAGATGGGGAGCCAGAAGGG - Intergenic
970409072 4:15790206-15790228 CATCAGAGGGAGACCGTGGAAGG - Intronic
970681874 4:18518199-18518221 AATCAGAAGGAAAGGAAGAAGGG - Intergenic
971427327 4:26529504-26529526 CAGCAGAAGGGGAGCAGGAAAGG + Intergenic
971635010 4:29047235-29047257 CTAGAGAGAGAGAGCAAGAAAGG - Intergenic
972653990 4:41048696-41048718 CATCAGAGGGAGACCGTGGAAGG - Intronic
973557324 4:52097502-52097524 CAGCAGAGAGAGCGCAAGGAGGG + Intergenic
973634787 4:52851974-52851996 AGTCAGAGGGAGAGCAGGACAGG - Intergenic
974345696 4:60678236-60678258 GATATGAGGGAAAGCAAGAATGG - Intergenic
974725367 4:65792246-65792268 AGACAGAGAGAGAGCAAGAAAGG - Intergenic
975649922 4:76582831-76582853 AATCAGTGGCAGAGCCAGAAGGG + Intronic
975685418 4:76916103-76916125 CATCAGAGGGAGACCGTGGAAGG - Intergenic
975688649 4:76944219-76944241 CACAAGAGGGTGAACAAGAAAGG + Intergenic
976219769 4:82746955-82746977 CGTCAGGGGGAGAGGAGGAACGG + Intronic
976283741 4:83350359-83350381 CATGAGGGGGAGGGCAAAAAGGG + Intergenic
976290090 4:83409013-83409035 CATGAGAGGAAGAGGAAAAAAGG + Intronic
976457558 4:85265850-85265872 CAGGAGAGAGAGAGCAAGCAAGG + Intergenic
977320117 4:95503213-95503235 CATGAGAGAGAAACCAAGAAGGG - Intronic
978408967 4:108408843-108408865 CATCAGAGGGAGACCGTGGAAGG - Intergenic
978578708 4:110211704-110211726 TATCAGAGGGATAGCAAAAGAGG - Intergenic
978578731 4:110211820-110211842 CATCAGAGAGAGACCATGACTGG + Intergenic
978645764 4:110929567-110929589 CATCAAAGAGAGAACAAAAAGGG - Intergenic
979140175 4:117162554-117162576 CAGCAGATGGGGAGCCAGAAGGG - Intergenic
979186435 4:117800886-117800908 TTACAGAGGCAGAGCAAGAAAGG + Intergenic
979273574 4:118791548-118791570 CATCAGAGGGAGACCGTGGAGGG - Intronic
979974520 4:127180412-127180434 CCTCAGAGGGTGAGCAATAGAGG + Intergenic
980329001 4:131386845-131386867 CAGGTGAGGGAGAGGAAGAAGGG + Intergenic
981729849 4:147885702-147885724 GATCTGAGGGAGAACCAGAATGG - Intronic
982040247 4:151390193-151390215 CATCAGAGGGAGACCGTGGAAGG - Intergenic
982452365 4:155568924-155568946 CAACATAGTGAGAGCCAGAAGGG - Intergenic
982494847 4:156077746-156077768 CATCAGAGAGTGAGCAAGACAGG + Intergenic
983669683 4:170221659-170221681 CAAGAGAGAGAAAGCAAGAAAGG - Intergenic
983747581 4:171220946-171220968 GGGCAGAGGGAGAGCAAGAGTGG + Intergenic
984403335 4:179295107-179295129 CATCAAAGAGTGAGCAAGACGGG + Intergenic
984708764 4:182867265-182867287 AGTCAGAGAGAGAGGAAGAAAGG - Intergenic
984804404 4:183737761-183737783 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1202769188 4_GL000008v2_random:185445-185467 GCTTAGAGGAAGAGCAAGAAAGG - Intergenic
986145159 5:5071253-5071275 CATGAGGGAGAGAGAAAGAAGGG - Intergenic
987031149 5:13977903-13977925 CATGAGAGGGAGAGAAAGAGAGG + Intergenic
987211926 5:15692427-15692449 CAACAGAGGGAGATACAGAATGG - Intronic
987366873 5:17156656-17156678 CATCAGAGTGAGATCAGGGAGGG - Intronic
987935604 5:24460516-24460538 CATCAGAGGAATAGAAGGAATGG + Intergenic
987960358 5:24799375-24799397 TATTAGAGAGAGAGGAAGAAAGG - Intergenic
988282981 5:29173703-29173725 CATCAGGTAGAGAGTAAGAAAGG - Intergenic
989398234 5:40981422-40981444 CATCGGAGTGCGAGGAAGAAGGG + Exonic
989496598 5:42116245-42116267 CATCAAAAGGAGAGCGAGAGGGG + Intergenic
989588164 5:43089091-43089113 CATCAGAGGGAGACCGTGGAAGG + Intronic
990148207 5:52787477-52787499 AGTAAGAGGGAGAGCGAGAAGGG - Intergenic
990320912 5:54628835-54628857 CATCAGAAGGACAGGCAGAAAGG - Intergenic
991375248 5:65958593-65958615 CATCAGAGGGAGACCGTGGAAGG + Intronic
992002307 5:72447569-72447591 CCTCAGAGGTGGAGCAAGTAGGG + Intronic
992930967 5:81644721-81644743 CATAAGAGGGAGAACCAGAGTGG + Intronic
992977839 5:82138876-82138898 CATGAGAGGGAGAGGGAGAGGGG - Intronic
993178691 5:84520498-84520520 CACCACAGGGAAAGCAATAAGGG - Intergenic
994011254 5:94905594-94905616 GATGAGAGTGAGAGAAAGAAAGG + Intronic
994440094 5:99791067-99791089 CAGGAGAGAGAGAGCAAGAGAGG + Intergenic
995779575 5:115761393-115761415 TAAGAGAGGGAGAGTAAGAAAGG + Intergenic
997526349 5:134555468-134555490 CTTCAGAGCCAGAGCCAGAAGGG + Intronic
998007046 5:138663929-138663951 CAGCAGAGTGAGAGAAAGAGGGG + Intronic
998216564 5:140242104-140242126 GCTCAGAGGGAGAGGATGAATGG - Intronic
998664710 5:144283366-144283388 AATCAGTGGGAGAGAAAGTATGG + Intronic
999773867 5:154795472-154795494 CAAGAGAGGGAGAGAAAGGAAGG - Intronic
1000103602 5:158037980-158038002 CATCAGAGGGAGACCGGGGAGGG + Intergenic
1000555956 5:162726250-162726272 CATCAGGGAGAAGGCAAGAATGG - Intergenic
1000576060 5:162976381-162976403 CATCAGATGGAGAGAAGGTAAGG - Intergenic
1001368386 5:171168943-171168965 AATCAGAGGGAGAGAAAAAGAGG - Intronic
1001721403 5:173859981-173860003 CATGGCAGGGAGAACAAGAAGGG + Intergenic
1001730103 5:173947299-173947321 CCTTAGAGGGAGAGGAAAAAGGG - Intronic
1001927175 5:175646370-175646392 CACATGAGGGAGAGCAAGCAAGG + Intergenic
1002331861 5:178448607-178448629 GGTGAGAGAGAGAGCAAGAAGGG + Intronic
1002437281 5:179239312-179239334 CATCAGTGTGAGAGGAAGAGAGG + Intronic
1003060285 6:2857573-2857595 CTTCTCAGGGAAAGCAAGAAGGG - Intergenic
1003092309 6:3114536-3114558 CCCCAGAGGGAGGGCGAGAAGGG + Exonic
1003319629 6:5038849-5038871 CATCAGAGGGAGACCGCGGAAGG + Intergenic
1003862997 6:10338812-10338834 CATAAGATGGAGAGAAAAAAAGG - Intergenic
1004075446 6:12340357-12340379 CGTCTGATGGAAAGCAAGAAAGG - Intergenic
1004126769 6:12881831-12881853 CAGCAGAGAGTGAGAAAGAAGGG + Intronic
1004776613 6:18853588-18853610 CAATAGAGGGAAAGCTAGAAGGG - Intergenic
1005150851 6:22748845-22748867 CACCATAGGGAGAGCACAAATGG - Intergenic
1005400053 6:25422863-25422885 CCTCAGGGGCAGAGCAAGGAGGG - Intronic
1005443254 6:25894249-25894271 AATGAGAGGGAGAAAAAGAAGGG - Intergenic
1005837032 6:29717921-29717943 CATGAGAGGGAGAGGGAGACGGG - Intergenic
1006502702 6:34468525-34468547 GGGCAGAGGGAGGGCAAGAAGGG - Intronic
1006526595 6:34611078-34611100 CATCAGAAAGAAAGAAAGAAAGG - Intronic
1006766372 6:36510230-36510252 CATGAGAGGGAGGCCAAGCAGGG - Intronic
1007341223 6:41192584-41192606 AACCAGAGGCAGAGCCAGAAAGG - Intronic
1007400169 6:41598815-41598837 CAGCAGAGGCAGAGGAAGACAGG + Exonic
1007633996 6:43287241-43287263 CAGCAGAGGGAGTGGAGGAAGGG + Exonic
1008057629 6:46961717-46961739 GAACAGTGGAAGAGCAAGAATGG - Intergenic
1008480531 6:51981369-51981391 CATCAGAGGGAGACCGTGGAGGG - Intronic
1008890863 6:56488406-56488428 CATCAGAGGGGAAGGAAGGAAGG + Intronic
1008926785 6:56895989-56896011 CATGAGAGGGAGAGGGAGACGGG + Intronic
1010367828 6:75072459-75072481 CATCAAAGGGAAAGAAATAAAGG + Intergenic
1011909312 6:92415804-92415826 CCACAGGGGCAGAGCAAGAAAGG + Intergenic
1011931475 6:92720089-92720111 CATAAGAGAGAGAACAAGAAGGG + Intergenic
1012769036 6:103405274-103405296 CAGCAGAAGGAGAGCTGGAAAGG + Intergenic
1013040005 6:106424012-106424034 CATGAGAGAGAGAGAAGGAAAGG - Intergenic
1013721633 6:113037155-113037177 CATCAGATGGGGAAAAAGAATGG - Intergenic
1014057785 6:117036624-117036646 CAGGAGAGAGAGAGAAAGAAGGG - Intergenic
1014214164 6:118736840-118736862 CATCAGAGGCAGAGAAGGGAAGG + Intergenic
1014559180 6:122870366-122870388 CATGAGAGAGACAGCAAGAGGGG - Intergenic
1014745314 6:125193517-125193539 CATCACAGAGAGAGCACCAAAGG - Intronic
1014764408 6:125390099-125390121 CATGAGAGGGAGAGGGAGACGGG + Intergenic
1015546653 6:134368434-134368456 CATGAGAGCGAGAGCAGGCAAGG + Intergenic
1016391525 6:143580113-143580135 CAAGAGAGGGATAGCAAGATGGG + Intronic
1016638846 6:146325226-146325248 CATAAGAGGGACAAAAAGAAAGG + Intronic
1016869907 6:148806811-148806833 CATGAGATAGAGAGCAAGAGAGG + Intronic
1018278013 6:162153674-162153696 CAGCAGAGGGGGAGCTGGAAAGG + Intronic
1019459303 7:1147934-1147956 CATCAGAGGGAGACCGTGGAGGG + Intergenic
1019648085 7:2141626-2141648 AATTAGAGGGAGAGAGAGAAGGG - Intronic
1019715176 7:2535260-2535282 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1019757469 7:2783446-2783468 CCTCAGAGGGTGAGGATGAATGG - Intronic
1020023002 7:4880228-4880250 CCTCAGAGGAAGAGAAACAAAGG - Intronic
1020404908 7:7821776-7821798 CATCAGGGGAAGAGGCAGAAAGG - Intronic
1021419904 7:20434568-20434590 CATCATAGGGAAATCAAGAAAGG + Intergenic
1021735151 7:23635906-23635928 CATCAGAGGGAGACCGTGGAAGG - Intronic
1022028686 7:26471807-26471829 AGTCAGAGAGAGAGAAAGAAAGG - Intergenic
1022495320 7:30849621-30849643 CAGCGGAGGCAGAGGAAGAAGGG - Intronic
1023367852 7:39482522-39482544 TATCAGAAGGAAAGAAAGAAAGG - Intronic
1023798879 7:43815619-43815641 AGTCAGAGAGAGAGAAAGAAAGG + Intergenic
1023976910 7:45037272-45037294 AATCAGTGAGAGAGCAAGAGAGG - Intronic
1024162160 7:46688008-46688030 CAGAAGAGAGAGAGCAAGCAAGG + Exonic
1024741499 7:52359978-52360000 CAGGAGAGAGAGAGCAAGAGGGG + Intergenic
1025781817 7:64608726-64608748 CAGCATAGGCAGGGCAAGAAAGG - Intergenic
1025979687 7:66395044-66395066 CATCAGAGGGAGACCGTGGAGGG + Intronic
1026683396 7:72487664-72487686 CAGCAGAGTGAAAGAAAGAAAGG + Intergenic
1028791038 7:94853270-94853292 CAAGAGAGGGGGAGCAAGAGAGG - Intergenic
1028813883 7:95121753-95121775 CAAGTGAGAGAGAGCAAGAAGGG + Intronic
1031473560 7:122195619-122195641 CATCAGAAAGAAAGGAAGAAAGG + Intergenic
1031837070 7:126691167-126691189 CATGAGAGGGAGGCCAAGAAGGG - Intronic
1032563208 7:132913748-132913770 CAGCAGAGGGAAGGAAAGAAAGG + Intronic
1033003989 7:137540276-137540298 TATCAGAAAGAAAGCAAGAAGGG + Intronic
1033323597 7:140361572-140361594 CATCAGAGGGAGACCGTGGAAGG - Intronic
1033529059 7:142244985-142245007 CACAATAGGGAGAGGAAGAAAGG + Intergenic
1034063941 7:148118857-148118879 AATAAGAGGCAGAGCAAGAGAGG + Intronic
1034096619 7:148414575-148414597 AATTAGAAGGAGAGCCAGAAAGG - Intronic
1034961979 7:155368406-155368428 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1035862595 8:3046309-3046331 AATGAGTGTGAGAGCAAGAAAGG + Intronic
1036017404 8:4800572-4800594 CGTCAGAGGCAGAGCAGGGAAGG + Intronic
1038594947 8:28880282-28880304 CATCAGAGGGAGACCGTGGAGGG - Intronic
1038745043 8:30247855-30247877 CATCAGAGGGAGACCGTGGAAGG + Intergenic
1039025554 8:33254128-33254150 CAACATAGGGAGACCAAAAAAGG - Intergenic
1039583455 8:38685723-38685745 CATCTTAGTGAGAGAAAGAAAGG - Intergenic
1039798697 8:40936410-40936432 AATGAGAATGAGAGCAAGAAAGG + Intergenic
1040070180 8:43181065-43181087 CATCAGAGGGAGACCGTGGAGGG + Intronic
1040077453 8:43251784-43251806 CTTCAGAGGAAAAGCAAGAAAGG + Intergenic
1040083713 8:43315909-43315931 CATCAGAGGAAGAGCCACAAAGG + Intergenic
1040407796 8:47124878-47124900 CATCAGAGGAAGAGCCACAAAGG - Intergenic
1040818482 8:51533517-51533539 CATCAGAGGGAGACCGTGGAGGG - Intronic
1042887221 8:73565294-73565316 CAGGAGAGAGAGAGCAAGCAGGG - Intronic
1042943108 8:74127305-74127327 CACCAGAAGGAGAGGAACAAAGG + Intergenic
1043703336 8:83318458-83318480 AAGGAGAGGGAGAGAAAGAAAGG - Intergenic
1044245446 8:89939183-89939205 CAGCAGAGGTAGAGAAAGAAGGG + Intronic
1044647983 8:94464885-94464907 CACAAGAGGGAGAGCAAAAGAGG + Intronic
1045120610 8:99029748-99029770 CATCAGAGGGAGACCGTGGAAGG + Intronic
1045330049 8:101147814-101147836 CATCAGAGAGTGGGCAAGATTGG - Intergenic
1045558921 8:103241855-103241877 CATCAGAGAGGGAGAAAGGAAGG - Intergenic
1045655037 8:104377757-104377779 AATCAGAGGGAGAGAAACACAGG + Intronic
1046277441 8:111982231-111982253 CAGCAGATGGGGAGCCAGAAGGG + Intergenic
1046636106 8:116678013-116678035 CATCAGAGGGAGACCGTGGAAGG - Intronic
1046665642 8:116999411-116999433 CATGAGAGTGACAGCAAGAGAGG + Intronic
1046703444 8:117426195-117426217 CAACAGAGGGAGACCAAAGAAGG - Intergenic
1046849689 8:118958098-118958120 CTACAGTGGGAGAGAAAGAATGG + Intergenic
1048025904 8:130586385-130586407 GATCAGAGGGAGAGGAGAAAGGG + Intergenic
1048514168 8:135090766-135090788 GAAGAGAGAGAGAGCAAGAAAGG - Intergenic
1050572028 9:6949814-6949836 CATCAGAGGGAGACCGTGGAGGG + Intronic
1050682926 9:8134940-8134962 TATCAGAGGGAAAGCTAGAACGG + Intergenic
1051686196 9:19660486-19660508 TATAGGAGGGAGGGCAAGAAAGG + Intronic
1052743384 9:32415717-32415739 CAAAAGAGGGAGAGAAAGGAGGG - Intronic
1052744879 9:32430842-32430864 CATTAAAGTGAGAGCTAGAAAGG - Intronic
1052874387 9:33543203-33543225 CTTCAGAGGAAAAGCAAGAAAGG + Exonic
1053501644 9:38601161-38601183 CTTCAGAGGAAAAGCAAGAAAGG - Intergenic
1053659493 9:40257438-40257460 CTTCAGAGGAAGAGCAAGAAAGG + Exonic
1053909865 9:42886796-42886818 CTTCAGAGGAAGAGCAAGAAAGG + Intergenic
1054360525 9:64110189-64110211 CTTTACAGGAAGAGCAAGAAAGG + Intergenic
1054371622 9:64403735-64403757 CTTCAGAGGAAGAGCAACAAAGG + Exonic
1054525105 9:66118779-66118801 CTTCAGAGGAAGAGCAAGAAAGG - Exonic
1054679239 9:67893454-67893476 CTTCAGAGGAAGAGCAAGAAAGG + Exonic
1054916317 9:70498153-70498175 GAGCAGAGAGGGAGCAAGAAAGG + Intergenic
1055501263 9:76904863-76904885 CAACAAAGGGAGTGCAGGAAGGG - Intronic
1055507289 9:76961424-76961446 GAGCAGAGGGAGAGCGAGAAGGG - Intergenic
1055815751 9:80203352-80203374 AAAGAGAGGGAGAGCAAAAAGGG - Intergenic
1056074118 9:83020852-83020874 CAGCAGATGGAGAGAAAAAAAGG + Intronic
1056443146 9:86640200-86640222 CATGGGAGGGAAGGCAAGAAGGG - Intergenic
1056454309 9:86745419-86745441 TATCGTAGGGAGAGCAAGCAGGG - Intergenic
1056998578 9:91487043-91487065 GATCAGAGAGAGAGAAAAAAAGG + Intergenic
1057517635 9:95735555-95735577 GATCAGAGCCAGATCAAGAAGGG - Intergenic
1057681038 9:97185472-97185494 CTTCAGAGGAAAAGCAAGAAAGG - Intergenic
1057843487 9:98504219-98504241 CATGAGACAGAAAGCAAGAAAGG + Intronic
1058300371 9:103364141-103364163 GATGAGAGTGACAGCAAGAATGG + Intergenic
1058366215 9:104211743-104211765 CACAAGAAAGAGAGCAAGAAAGG + Intergenic
1061378430 9:130239979-130240001 CAGCAGAGGGTGAGCTTGAACGG + Intergenic
1062182618 9:135198722-135198744 CACCAAAGGGAGAGCAAGCCAGG + Intergenic
1203529089 Un_GL000213v1:121103-121125 CATCAGAGGAAGAGTCACAAAGG - Intergenic
1203694071 Un_GL000214v1:79161-79183 CTTTAGAGGAAGAGCAAGAAAGG - Intergenic
1203705478 Un_KI270742v1:38262-38284 CTTTAGAGGAAGAGCAAGAAAGG + Intergenic
1203558523 Un_KI270744v1:27541-27563 CTTTAGAGGAAGAGCAAGAAAGG - Intergenic
1203642202 Un_KI270751v1:24902-24924 CTTTAGAGGAAGAGCAAGAAAGG + Intergenic
1185935933 X:4257282-4257304 CATGAGAGGGAGGCCAAGGAAGG + Intergenic
1186400836 X:9258001-9258023 GCTCAGAGGGAGAGAAGGAATGG + Intergenic
1186788714 X:12976119-12976141 CAGCAGTAGGAGAGCGAGAAGGG + Exonic
1186895214 X:13998444-13998466 CAGGAGAGAGAGAGCACGAAGGG - Intergenic
1186992643 X:15086019-15086041 CATCAGAATGAATGCAAGAAGGG + Intergenic
1188368141 X:29335235-29335257 CATCAGAGGGAGACCGTGGAGGG + Intronic
1189110558 X:38285972-38285994 AAGGAGAGGGAGAGGAAGAAGGG - Exonic
1189636865 X:43020306-43020328 GGTCACAGGGAGATCAAGAAAGG + Intergenic
1189838235 X:45042224-45042246 CATCAGAGGGAGACCGTGGAAGG + Intronic
1190778799 X:53577542-53577564 CATCAGAGGGAGACCATGGAAGG - Intronic
1191607183 X:63075581-63075603 CATCAGAGGAAGATTAAAAATGG + Intergenic
1191835201 X:65456462-65456484 CATCAGAGGGAGACCATGGAAGG - Intronic
1194068265 X:89288375-89288397 CAGCAGTGGGGGAGCCAGAAGGG + Intergenic
1196423203 X:115543964-115543986 CAGCAGAGAGAGAGAGAGAAAGG - Intergenic
1197998649 X:132408552-132408574 AATCAGAGAGAGAAGAAGAAAGG + Intronic
1200122066 X:153795783-153795805 CATCAGAGGGTGTGAAACAAAGG - Intronic
1200722408 Y:6622544-6622566 CAGCAGTGGGGGAGCCAGAAGGG + Intergenic
1201269418 Y:12240070-12240092 CATCAGAGGCTGAGCATAAATGG - Intergenic
1201605561 Y:15780461-15780483 CAGCAGGGAGAGAACAAGAAGGG + Intergenic