ID: 1154179792

View in Genome Browser
Species Human (GRCh38)
Location 18:12124761-12124783
Sequence CCATGGAAGTAACTGTGATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 1, 2: 1, 3: 17, 4: 193}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154179792 Original CRISPR CCATGGAAGTAACTGTGATG TGG Intronic
901034088 1:6325922-6325944 CCTTGGATGTGCCTGTGATGTGG - Intronic
901162421 1:7188994-7189016 CCATGCTAGTAAGTGTGAAGTGG + Intronic
902084555 1:13848927-13848949 TCATGAAAGTACCTGGGATGGGG + Intergenic
907037770 1:51231450-51231472 CTATGGAAAGCACTGTGATGTGG + Intergenic
907575006 1:55518579-55518601 CCATGGAAACAACTTTGTTGAGG - Intergenic
908586657 1:65577181-65577203 CAATTGAAGTGAATGTGATGTGG - Intronic
908848544 1:68350102-68350124 CCATTGAAGTGAGCGTGATGAGG + Intergenic
911378448 1:97081009-97081031 ACATGAAAGTAAATGTGATATGG + Intronic
918237906 1:182598093-182598115 TCATAGAAGTATCTGAGATGAGG - Intergenic
918386872 1:184017572-184017594 CCCTGGACGTATCTGTGATCTGG - Intronic
919453845 1:197800801-197800823 CCCTGGGAGCCACTGTGATGAGG + Intergenic
919710808 1:200726237-200726259 CCATGGAAGTAATTTGGATGGGG + Intergenic
920953920 1:210599969-210599991 AGATGGAAGTACCTGTGTTGGGG - Intronic
921712629 1:218387968-218387990 ACATGGAAATGACTGTGATCTGG + Intronic
924394811 1:243607278-243607300 CCATGAAAGTAGCTGGGAGGAGG + Intronic
1062999039 10:1897081-1897103 GCATTGATGTAACTGTGCTGAGG - Intergenic
1063240564 10:4165349-4165371 CCATGGAAGTCTCTGTGCTCTGG + Intergenic
1068936794 10:62643662-62643684 CCATGGAAATAACTGGGGGGTGG - Intronic
1075792392 10:125094436-125094458 CCAAGGAAGCAACGATGATGTGG + Intronic
1077187879 11:1243555-1243577 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188300 11:1245226-1245248 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188835 11:1247326-1247348 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077189254 11:1248997-1249019 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1078532948 11:12151078-12151100 CCCTGGAAGCCAATGTGATGTGG - Intronic
1081173748 11:39900569-39900591 CAATAAAAGTAACTATGATGTGG + Intergenic
1083762814 11:64827851-64827873 GCATGGTAGTTACTGTGCTGTGG - Intronic
1083811942 11:65111216-65111238 CGATGGAAGTAGCTGGGATGAGG - Intronic
1084615544 11:70233383-70233405 TCATTGAAGTCACTGTGATTTGG + Intergenic
1084905382 11:72342122-72342144 ACATGGAAGAAAGTGTGAGGAGG + Intronic
1088340446 11:108759709-108759731 CCATGGAAAAAAAAGTGATGCGG - Intronic
1088554204 11:111045140-111045162 ACAAGGAAGTAGCTGTGCTGTGG + Intergenic
1089567159 11:119377880-119377902 CCATGAAGGTTACTGGGATGTGG - Intronic
1090104771 11:123841152-123841174 CGATGGAAATGACGGTGATGTGG + Intergenic
1092916041 12:13189869-13189891 CCATGGAAGAAACTGAGACCTGG + Intergenic
1093091432 12:14925249-14925271 CCATGGAAGGAACTATAGTGAGG + Intronic
1094020159 12:25905349-25905371 CCATGTAAGTATCTGTTATTTGG + Intergenic
1095602414 12:44028891-44028913 CCATGGAAGGTACTATAATGCGG + Intronic
1097852932 12:64431392-64431414 AGATGGAAGTAATTGTGATGTGG + Intronic
1098586292 12:72157660-72157682 CCATGGAAGAAAATGGGAAGGGG + Intronic
1098891128 12:76011698-76011720 CCATGGAAATCACTGTGACTTGG - Intergenic
1100387301 12:94115479-94115501 CGCAGGAAGAAACTGTGATGTGG + Intergenic
1104579785 12:130002754-130002776 CCATGGATGTACCTGACATGAGG + Intergenic
1106521518 13:30502411-30502433 GCAAGGAAGGAACTGAGATGGGG - Intronic
1107806576 13:44159005-44159027 ACTTGGAAGTAAATGTGAGGAGG + Intronic
1109561742 13:64058488-64058510 GCATGGAAGAGACTTTGATGTGG + Intergenic
1109721360 13:66280467-66280489 CCATGGAAATTACGGTAATGTGG + Intergenic
1110382651 13:74872017-74872039 CCATAAAAATAACTCTGATGTGG - Intergenic
1110804991 13:79744145-79744167 CCATGGAAATAACTCTTTTGGGG + Intergenic
1110990224 13:82032604-82032626 CAATGTAACTAACTGAGATGTGG - Intergenic
1112134147 13:96557188-96557210 CCTTGCAAGTACCTGTGAGGTGG + Intronic
1112626037 13:101105364-101105386 CCCTGCATTTAACTGTGATGTGG + Intronic
1114680102 14:24477075-24477097 TCATGGAAGCAGCTGTAATGAGG - Intergenic
1115910848 14:38255341-38255363 CGATGCAAGTAACTGAGATCGGG + Exonic
1117659718 14:57991137-57991159 CAAGGGAAGAAACTGTGATCTGG - Intergenic
1119102239 14:71890585-71890607 CCCTAGAATTAACTGTGCTGAGG - Intergenic
1120093903 14:80366075-80366097 GCATGGGAGTAGCTGTGGTGGGG - Intronic
1120103915 14:80473390-80473412 CCATCAAAGTAACTGGGAGGGGG - Intergenic
1122849685 14:104521037-104521059 TCATGGGAGTAACTGTGAGCTGG + Intronic
1125375002 15:39019465-39019487 CCAAGGAAGAAACTGAGATGGGG + Intergenic
1128290207 15:66472633-66472655 CCAAAGAAGTATGTGTGATGAGG + Intronic
1129377899 15:75145597-75145619 CCCTGGGAGCCACTGTGATGAGG - Intergenic
1129931135 15:79412080-79412102 CCAGTGCAGTAGCTGTGATGCGG + Intronic
1130726303 15:86442959-86442981 GCAAGGAAGTAAAAGTGATGGGG + Intronic
1130938823 15:88491203-88491225 GCATGGCAGTCACTGTGCTGGGG + Intergenic
1135208889 16:20507248-20507270 CCATGAAAGCAGCTGGGATGGGG - Intergenic
1139598922 16:67974803-67974825 CCATGGAAGGAACTTAGATCTGG + Intergenic
1143295898 17:5871757-5871779 CCATGGAAGCCACAGTGATTCGG + Intronic
1144029518 17:11306849-11306871 CCATGGAAATAAAGGAGATGGGG - Intronic
1151085211 17:71372453-71372475 CCAAGGAAGTAACCATGATGGGG + Intergenic
1151180633 17:72325115-72325137 CCATGGGAGTAACAGGGATATGG + Intergenic
1152178020 17:78800578-78800600 CCATGGAAGCCACTGTGTGGGGG - Intronic
1152631892 17:81414199-81414221 CCATGGCAGGACCTGTGCTGGGG + Intronic
1152889432 17:82872062-82872084 CCAGGGAAGTAACCGGGTTGAGG - Intronic
1154179792 18:12124761-12124783 CCATGGAAGTAACTGTGATGTGG + Intronic
1156162334 18:34374389-34374411 CCATGGAAGGAACCTGGATGAGG - Intergenic
1156307044 18:35886940-35886962 GTATGTAAGGAACTGTGATGAGG + Intergenic
1156569326 18:38235031-38235053 CCATGGTAGGAAGTCTGATGGGG + Intergenic
1159153463 18:64551614-64551636 CAAAGGAAATAACTGTTATGGGG - Intergenic
1162784871 19:13028385-13028407 TCATGACAGTAACGGTGATGTGG + Intronic
1163225360 19:15956827-15956849 TCATGGGAGTAACTGGGATTTGG + Intergenic
1163681070 19:18683042-18683064 AGATGGAGGTAAATGTGATGCGG - Intergenic
1165019177 19:32909008-32909030 GCATGGAAGGAACAATGATGCGG + Intronic
1168589155 19:57618357-57618379 CCATGGAGGTACCAGTGTTGTGG + Intronic
927321551 2:21752793-21752815 TCATGGTAGAAAGTGTGATGGGG + Intergenic
927629315 2:24758189-24758211 CCTCAGAATTAACTGTGATGTGG - Intronic
927658480 2:24971838-24971860 CCATGGAGATGACTTTGATGCGG + Exonic
928266141 2:29813454-29813476 CTAAGGAAATAACTGTGTTGAGG + Intronic
929285862 2:40134491-40134513 CTATGGTGGGAACTGTGATGAGG - Intronic
932802263 2:74751401-74751423 CCATGGATGAAACTGTAATCAGG + Intergenic
933210465 2:79561622-79561644 CCATGGTAGTGAGTGTGAAGTGG + Intronic
936835205 2:116701482-116701504 GCTTGGAAGTCACTGTGAAGAGG - Intergenic
941664825 2:168234230-168234252 CCATGTAACTTTCTGTGATGAGG + Intronic
942907933 2:181206282-181206304 CCATGAAAGTAACTGGGAAGGGG - Intergenic
943419677 2:187655054-187655076 CCCTGGGAGTGACTGAGATGGGG - Intergenic
943423372 2:187698051-187698073 CCATGAAAGTAGCTGGGAGGGGG + Intergenic
943797367 2:192013344-192013366 CCATGCAAGTATCTGAGATTAGG - Intronic
944529513 2:200653403-200653425 CCATGGAAGGACCTGGGCTGGGG + Intronic
947024690 2:225723931-225723953 CCATGGAGGTAAGTGTGCTTGGG + Intergenic
947666841 2:231911257-231911279 CCATGGAGGTGACTGTGAGGAGG + Intergenic
1168955580 20:1832259-1832281 CCATGCAAGGAACCGTGCTGGGG + Intergenic
1170064091 20:12292000-12292022 CCATGAAAGGAAATATGATGAGG + Intergenic
1173668641 20:44781802-44781824 CCTTGGAAGGAACTGGGTTGTGG + Intronic
1178902487 21:36608449-36608471 CCATGGAAGACACTGGGATCCGG - Intergenic
1180566854 22:16676729-16676751 CCATGGAAGTAACTGTGATCTGG - Intergenic
1180639533 22:17287225-17287247 CCATGGAAGGAAAGGAGATGAGG + Intergenic
1181890285 22:26056754-26056776 CCAGGGAAGAATCTGTGATTTGG + Intergenic
1182442248 22:30371399-30371421 CCATGGAGGCAACTGTGATGAGG - Intronic
1182933791 22:34200724-34200746 CAATAGAAGAAACTGAGATGTGG - Intergenic
1183946035 22:41326282-41326304 CTATGGAAGGAACAGTGAGGAGG - Intronic
1183946061 22:41326421-41326443 CTATGGAAGAAACAGTGAGGAGG - Intronic
1183946064 22:41326444-41326466 CTATGGAAGAAACAGTGAGGAGG - Intronic
1184574970 22:45356324-45356346 CCATTCAGGCAACTGTGATGAGG + Intronic
950657937 3:14448912-14448934 CCCTGGAAATAACTGAGATGAGG + Intronic
951049722 3:18080620-18080642 TCATTGAAGTAACTCTGCTGAGG - Intronic
954797457 3:53168813-53168835 TCAGGGAGGTAACGGTGATGGGG + Intronic
954957680 3:54536576-54536598 CCATGGAAGTAAGAGTGACATGG - Intronic
956819465 3:72940465-72940487 CCATGGAACAGACTGGGATGAGG + Intronic
958064698 3:88528576-88528598 CCATGGCAGCAACTGTGTGGTGG + Intergenic
960770474 3:121188246-121188268 ATATGGGAGTAAGTGTGATGCGG - Intronic
961655579 3:128439837-128439859 TCATGGAATTAACGGTGAGGTGG + Intergenic
961929531 3:130518011-130518033 CCATGCAAGTAATTTTGAAGAGG + Intergenic
962005628 3:131346635-131346657 CCATGAAATTAACTGTGAGGAGG + Intronic
963878273 3:150500941-150500963 CCATGAAAGTGGCTGGGATGGGG - Intergenic
964473977 3:157082357-157082379 ACATGGAAGAAACTGGGCTGAGG + Intergenic
965708373 3:171532431-171532453 TCATGGAAGTAACAGTGTTTTGG - Intergenic
966289181 3:178334761-178334783 CCATTGAAGGAGCTATGATGAGG + Intergenic
968351611 3:198060035-198060057 CCACAGAAGTAACTGTGATCTGG - Intergenic
968477769 4:820512-820534 CCATGGAGGCAACTGGGATCTGG - Intronic
969197587 4:5575434-5575456 CCATCGAAATAATTGTGAGGGGG - Intronic
972054300 4:34780582-34780604 CCATGAAAGCAGCTGGGATGAGG - Intergenic
973601519 4:52547345-52547367 CTATGGAAGTATCTGTGATAAGG + Intergenic
973743806 4:53944145-53944167 CCATGTAAGTAAATGTCATTCGG + Intronic
975870109 4:78770996-78771018 CCATGGAAGAAAATCAGATGTGG - Intergenic
977545108 4:98367570-98367592 CCATGAAAGTAACCAGGATGGGG + Intronic
978036287 4:103999342-103999364 ACATGGAACATACTGTGATGTGG + Intergenic
979515881 4:121609544-121609566 CCCTGGAAGCACCTGGGATGAGG - Intergenic
980879106 4:138691522-138691544 ACATGGCAGAAACTGGGATGGGG - Intergenic
981563453 4:146072784-146072806 CCAAGGAAGTGAGTGAGATGGGG - Intergenic
984050772 4:174862227-174862249 CCATTGAAGTCATTGTGAGGTGG - Intronic
985469660 5:32222-32244 ACATGGAAGTGACTGTCCTGTGG + Intergenic
987851538 5:23361746-23361768 CCATGAAAGTAGCTGGGATGGGG - Intergenic
987927770 5:24364484-24364506 CCAGGGAAGAAACTGAGAGGTGG + Intergenic
988379370 5:30480802-30480824 CCATGGAAGCACCTGGGAGGGGG - Intergenic
989564837 5:42891933-42891955 TTATGGAAGTAACAGTGAGGGGG + Intergenic
990395729 5:55376506-55376528 CCATTGCAGTGACTGTAATGAGG + Intronic
991915119 5:71597859-71597881 CCATGTAAGTAAGTGAGAGGCGG + Intronic
998926019 5:147127476-147127498 CCATGAAAGCAGCTGGGATGGGG - Intergenic
1000132932 5:158317608-158317630 CCATGGGAGGGAGTGTGATGGGG - Intergenic
1000473584 5:161677037-161677059 GCATGGAAGTAATTATCATGGGG - Intronic
1001340085 5:170835177-170835199 CCATGGAAGTGACTGGACTGTGG - Intergenic
1001680348 5:173552447-173552469 ACACGGAAGAAACCGTGATGGGG - Intergenic
1001872294 5:175167367-175167389 CCAGGGAAGGAACTGTCATTAGG + Intergenic
1003344812 6:5257261-5257283 CCAGGGAGGTAAGTATGATGGGG - Intronic
1003619923 6:7690903-7690925 CCATGGAAGCCAGTGGGATGTGG - Intergenic
1003894291 6:10592210-10592232 CTATGGAAGTATCTGTTTTGTGG - Intronic
1004090307 6:12494252-12494274 CCAGGGCAGGAACTATGATGTGG - Intergenic
1004433219 6:15565135-15565157 CCATTGTAGTAGATGTGATGTGG - Intronic
1006723133 6:36173337-36173359 CCAAGGAAGTAATTCTTATGAGG + Intergenic
1007950171 6:45865082-45865104 CCATGCAGGTAACTGGAATGTGG - Intergenic
1008405665 6:51116188-51116210 GCCTGGAAGTAACTGTGAATAGG + Intergenic
1008705553 6:54154338-54154360 CCATGGAAGTAGAATTGATGAGG - Intronic
1011125891 6:84007223-84007245 ATGTGGAAGTCACTGTGATGTGG + Intergenic
1011337519 6:86277466-86277488 ACATGGAAGAAACTCTGATGAGG - Intergenic
1012092695 6:94919039-94919061 CCATGCAAGCATCTGTGAAGGGG - Intergenic
1012755679 6:103227438-103227460 CTATGGAAAAAACTATGATGGGG + Intergenic
1013098929 6:106971868-106971890 ACATGGAGGTAGCTGTGATGTGG - Intronic
1013485464 6:110592075-110592097 CCATGGTACTATCAGTGATGTGG - Intergenic
1017519833 6:155192091-155192113 TCAGAGAAGTAAATGTGATGAGG + Intronic
1019556439 7:1633807-1633829 CCATGAAGGTCACTGTGGTGGGG + Intergenic
1019659431 7:2215765-2215787 ACATGGAGGTTGCTGTGATGGGG - Intronic
1020639723 7:10740512-10740534 TCATGTAAGTAATTGTGAAGGGG + Intergenic
1022205450 7:28159235-28159257 CCAGGGAAGTAACTGGGAGTGGG + Intronic
1022499623 7:30874305-30874327 CCATGAAAGTAACAGGGTTGGGG + Intronic
1022708292 7:32827249-32827271 CCATGGAAGTTCCTGCGAAGGGG - Intergenic
1024384812 7:48739017-48739039 CCAAGAAAGCAGCTGTGATGGGG + Intergenic
1025271791 7:57527993-57528015 AAATGTAAGTAACTGTTATGTGG + Intergenic
1031637613 7:124120296-124120318 CCATGAAAGCAGCTGGGATGGGG + Intergenic
1031667402 7:124501759-124501781 TCATGGAAGTGATTGTGATAGGG + Intergenic
1033491972 7:141853143-141853165 CCATGAAAGCAGCTGGGATGGGG - Intergenic
1034040693 7:147874075-147874097 CCATGAAAGCAGCTGAGATGGGG - Intronic
1036364815 8:8111027-8111049 CCATGGAAGGAGCTGGGAGGGGG + Intergenic
1037477665 8:19273202-19273224 CCTTGGAATTAACTTTCATGTGG + Intergenic
1038852582 8:31294604-31294626 CCTTGCAAGAAGCTGTGATGTGG - Intergenic
1039457216 8:37715568-37715590 AGATGGAAGTAACGGTGATCAGG + Intergenic
1041205644 8:55495544-55495566 CCCTGGAAGCCACTGTGATGGGG - Intronic
1042057933 8:64786584-64786606 CCATGAAAGCAACTGGGAGGGGG - Intronic
1043587345 8:81784398-81784420 CCACAGAAGCAACTGTGATTTGG - Intergenic
1046340262 8:112845201-112845223 CTAATGAAGTAACTGTCATGTGG - Intronic
1048814849 8:138322836-138322858 CAAGGGAAGACACTGTGATGCGG + Intronic
1049252603 8:141597245-141597267 CCCTGGGAGCAACTCTGATGGGG - Intergenic
1052053915 9:23882414-23882436 CCATGAAAGCAGCTGGGATGGGG - Intergenic
1055111571 9:72565342-72565364 CCTTGGAAGTAATTATGAAGAGG + Intronic
1055563179 9:77542603-77542625 CAATGGCAGTAGCAGTGATGGGG + Intronic
1056762287 9:89424148-89424170 CCAGGGAAGTAGCTGTGGGGAGG - Intronic
1056831064 9:89917991-89918013 CCATGGAGGACACTGTGGTGTGG - Intergenic
1057979875 9:99650161-99650183 CCAGGGCAGGAACTATGATGTGG - Intergenic
1058132937 9:101274073-101274095 CCATGGAAGTCAATGTGATTTGG + Intronic
1058806526 9:108597683-108597705 CCAAGGAAGTAACTGGGACAGGG + Intergenic
1060561513 9:124548903-124548925 CCATGGCAGGAAGTGGGATGGGG - Intronic
1062267935 9:135695906-135695928 CCATGGCAGGAACTGTAATTGGG - Intronic
1062351256 9:136140292-136140314 CTATTGAGGGAACTGTGATGTGG + Intergenic
1186543689 X:10426600-10426622 ACAAGGAAGTGACTCTGATGAGG - Intergenic
1186870626 X:13767655-13767677 CCCTGGAAGCAACTGTGAACTGG - Intronic
1187448656 X:19378426-19378448 CCATGGATGTAAATGTCCTGAGG - Intronic
1194049597 X:89052942-89052964 CCATGAAAGCAGCTGAGATGGGG - Intergenic
1195352384 X:104007503-104007525 CCAGGGAAGAAAATGTGAAGTGG + Intergenic
1196783836 X:119405161-119405183 ACAGGGAAGTAAAGGTGATGTGG - Intronic
1197310241 X:124895987-124896009 CCATGAAAGGAAGTCTGATGGGG - Exonic
1197673444 X:129303785-129303807 CCATGGAAATACCTGAGATGGGG - Intergenic
1198532148 X:137557942-137557964 CCATGGAGGAATGTGTGATGAGG + Intergenic
1199349879 X:146787963-146787985 CCATGAAAGTAGCTGGGAGGTGG + Intergenic
1199851469 X:151727242-151727264 CCATGGAGGTAACTGGCCTGTGG - Intergenic
1201960543 Y:19676466-19676488 CTATGGAAGAAACAGTGCTGTGG - Intergenic