ID: 1154180097

View in Genome Browser
Species Human (GRCh38)
Location 18:12129396-12129418
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 2, 1: 0, 2: 3, 3: 19, 4: 196}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154180095_1154180097 22 Left 1154180095 18:12129351-12129373 CCTGTTGCAACAACTCAACACTA 0: 2
1: 0
2: 1
3: 22
4: 119
Right 1154180097 18:12129396-12129418 GTAAACAATATGCAGACTGAAGG 0: 2
1: 0
2: 3
3: 19
4: 196
1154180094_1154180097 23 Left 1154180094 18:12129350-12129372 CCCTGTTGCAACAACTCAACACT 0: 2
1: 1
2: 7
3: 29
4: 148
Right 1154180097 18:12129396-12129418 GTAAACAATATGCAGACTGAAGG 0: 2
1: 0
2: 3
3: 19
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
909229587 1:73069233-73069255 CGAAACAATATGCAGAATGCAGG + Intergenic
909940308 1:81603610-81603632 GTGAGCATTATGCAGAATGATGG - Intronic
911204420 1:95078000-95078022 GCAAAGAATAGACAGACTGAAGG + Intergenic
912154220 1:106897293-106897315 CTAAACAATATGCTCCCTGAAGG - Intergenic
913577535 1:120192180-120192202 GTAGAAAATATCCAAACTGAAGG - Intergenic
914331210 1:146672352-146672374 GGAAGCAATGTGCAGAGTGAGGG - Intergenic
914559449 1:148803607-148803629 GTAGAAAATATCCAAACTGAAGG - Intergenic
914613384 1:149326616-149326638 GTAGAAAATATCCAAACTGAAGG + Intergenic
915762959 1:158333751-158333773 GTAAACGATGTGCATACTCAGGG + Intergenic
916227251 1:162500916-162500938 GTAAAGTATATTCAGACAGACGG + Exonic
918165985 1:181948356-181948378 TTAGAAAATTTGCAGACTGATGG + Intergenic
918508940 1:185289091-185289113 GTAAAGAAGAGGCAGACTGGAGG - Intronic
918957666 1:191231121-191231143 GTAAACAATCTGAAGGTTGAAGG + Intergenic
919178594 1:194052634-194052656 GCAAACTATATCCAGACAGAAGG + Intergenic
921532551 1:216302864-216302886 ATAGACAACATGTAGACTGAAGG - Intronic
922384264 1:225066288-225066310 GGAAACAATTCACAGACTGAAGG - Intronic
923924338 1:238607560-238607582 GTCTGCAATATGCAGAATGACGG - Intergenic
924005223 1:239601607-239601629 TTAAAAAATATGAAGACTAAAGG - Intronic
924097861 1:240572823-240572845 GTAAGGAATATGCAGAGAGAGGG + Intronic
1063798224 10:9537970-9537992 GTAAACTATGTGCATAGTGAGGG + Intergenic
1064594522 10:16930019-16930041 GTACTCAGTATGAAGACTGAAGG - Intronic
1064940756 10:20732893-20732915 GGAAACAATGAGGAGACTGAGGG - Intergenic
1065567547 10:27029458-27029480 ATAAACAATATGCATATTGAAGG - Intronic
1066252306 10:33646504-33646526 ATAAACAATATGGAAACTGCTGG + Intergenic
1067165435 10:43863304-43863326 GAAAGCATTGTGCAGACTGAGGG + Intergenic
1068283429 10:54907045-54907067 GAAAAGAAAATGCAGAGTGATGG - Intronic
1068585984 10:58799193-58799215 ATCAACAGTATGCAGACCGAAGG + Exonic
1069269317 10:66505146-66505168 ATAAACAATAAGTAGACTGCAGG - Intronic
1069518379 10:69098289-69098311 GGAAACATTATGCAGAGTGAAGG + Intronic
1070358173 10:75660834-75660856 GTAAACAAGATGCAAGCAGATGG - Intronic
1072552114 10:96487008-96487030 GTGAACAATACGAAGACTGCAGG - Intronic
1076148750 10:128146241-128146263 GTAAACAAAATCCAGAATGTGGG + Intergenic
1080845311 11:36021617-36021639 TTGAAGAATATGCAGACTGTAGG + Intronic
1082040320 11:47679502-47679524 GTAGACAGTATGCAGTCTGGGGG + Intronic
1083361348 11:62110915-62110937 CTAAAAAATGTGCAGACGGAAGG - Intergenic
1084624723 11:70297440-70297462 GTAAACAATATGGAAACATATGG + Intronic
1086402213 11:86470058-86470080 GTGAACCAAATGCAGAGTGAGGG + Intronic
1087143022 11:94784992-94785014 GAAAATAATATGCAGCCAGATGG + Intronic
1093020070 12:14195080-14195102 GTAAAGGAGAGGCAGACTGAAGG + Intergenic
1094091003 12:26649701-26649723 GTCAATGATATGGAGACTGATGG - Intronic
1094259786 12:28480209-28480231 GGAAAGAAGATGAAGACTGAGGG - Intronic
1094740915 12:33287548-33287570 GTAAACAATATTCTGATTGTTGG + Intergenic
1096376272 12:51113872-51113894 GTAAACCATATACAGAAAGAAGG - Intronic
1096764785 12:53876038-53876060 TTAAACAATATGCTGTCTGCAGG + Intergenic
1097674570 12:62584764-62584786 GGAAACAATTTCCAGAGTGATGG + Intronic
1098802789 12:74983662-74983684 GTCAAAAATATCCAGTCTGAAGG - Intergenic
1099165027 12:79294823-79294845 GTAAACAAAACACAGACAGATGG - Intronic
1102943274 12:116962500-116962522 GAAAACAGTGTGCAGACTGCTGG + Intronic
1103483269 12:121265111-121265133 GTAAACAATAGGCAGTCACAAGG + Intronic
1104220840 12:126783676-126783698 GGAAACAAGATGCAGTCTGTAGG - Intergenic
1105200838 13:18174707-18174729 ACGAACAATATGCAGATTGAAGG - Intergenic
1109937689 13:69313244-69313266 TAAAACAATATGCAGGCTTAGGG + Intergenic
1109939018 13:69335025-69335047 TTAAACTATATACATACTGAGGG + Intergenic
1112471383 13:99692851-99692873 GAAAACATTATGCAGAGTGAAGG - Intronic
1113039930 13:106093795-106093817 GTAAACAAAATACAGGCTAAGGG - Intergenic
1113138055 13:107115711-107115733 GTAGACAATATGCAAACACATGG - Intergenic
1113148247 13:107233014-107233036 GAAAAGAATATGGGGACTGAAGG - Intronic
1114878069 14:26748288-26748310 GTAAACATGTTGGAGACTGATGG - Intergenic
1117787300 14:59299753-59299775 GTGAACAAAATGCAGTCTGTTGG + Intronic
1119585883 14:75834550-75834572 GTAAAAAATATACAGAGTAAGGG - Intronic
1120496322 14:85241486-85241508 TTCAACATTGTGCAGACTGAGGG - Intergenic
1120812368 14:88817187-88817209 GTAAACTATATGCATATTAAGGG + Intergenic
1121653987 14:95581589-95581611 GTGAACAAGCTCCAGACTGAGGG - Intergenic
1124666598 15:31598188-31598210 GAAAACTATATTCAGATTGATGG + Intronic
1126058655 15:44757097-44757119 GAAAAAAATATGCAGACTCAGGG + Intronic
1129569908 15:76670727-76670749 GAAAACAAAATGCAGACAAATGG - Intronic
1129846510 15:78770371-78770393 GTCAACAATGGGAAGACTGAGGG + Intronic
1129948701 15:79564718-79564740 TTAAAAAATAAGAAGACTGAGGG + Intergenic
1134115545 16:11545209-11545231 ATAGACAGAATGCAGACTGACGG + Intergenic
1134913773 16:18052038-18052060 GTAGACAATATGCAAACAAATGG - Intergenic
1135037482 16:19090070-19090092 GAAAACAATATGCTAAGTGAAGG + Intergenic
1135758012 16:25114069-25114091 CTAAACAATATTCAGCCTGGAGG - Intronic
1139093545 16:63677684-63677706 AGAAACATTATGCAGAGTGAAGG + Intergenic
1140002343 16:71038549-71038571 GGAAGCAATGTGCAGAGTGAGGG + Intronic
1147033790 17:37664193-37664215 GTGAAAAATATAAAGACTGATGG - Intergenic
1147541335 17:41362600-41362622 GGGAATAATCTGCAGACTGAGGG + Intergenic
1154180097 18:12129396-12129418 GTAAACAATATGCAGACTGAAGG + Intronic
1157267433 18:46239290-46239312 CTAAACAATATGCAATCTTATGG - Intronic
1158884300 18:61810904-61810926 GGAAACAAAATGCTGACTGGTGG + Exonic
1159487394 18:69081255-69081277 GTAAAAATTATGCAGAGTAATGG + Intergenic
1159681259 18:71355513-71355535 GGAAACAATATAGAGAATGATGG + Intergenic
1161933119 19:7354410-7354432 GTAAACAATTGGGAGACTGAAGG + Intronic
1164872506 19:31657601-31657623 GTACACAATACACAGACTGGGGG - Intergenic
1167837934 19:52089944-52089966 GTACACAAACTGCAAACTGAAGG + Intronic
927217087 2:20673862-20673884 GTAAACAAAGAGCACACTGAGGG - Intergenic
927808272 2:26167385-26167407 ATTAACAAAATGCAGACTGTAGG + Intergenic
928387978 2:30885649-30885671 GTGAGCAAAAGGCAGACTGAGGG + Intergenic
931426645 2:62177774-62177796 TCAAACCATATCCAGACTGAAGG + Intergenic
933465981 2:82652484-82652506 TCAAGCAAAATGCAGACTGAAGG - Intergenic
934116648 2:88804163-88804185 ATTAACGATATGCAGATTGAAGG + Intergenic
934625964 2:95852391-95852413 ATGAACAATATGCAGACTGAAGG - Intronic
934807611 2:97248927-97248949 ATGAACAATATGCAGACTGAAGG + Intronic
934829899 2:97508260-97508282 ATGAACAATATGCAGACTGAAGG - Intronic
935435164 2:103023252-103023274 GGAAACACTCTGGAGACTGAGGG - Intergenic
936559389 2:113523572-113523594 GTAAACTATATGCATATTCACGG - Intergenic
937438663 2:121899194-121899216 AGAAAAAACATGCAGACTGAAGG - Intergenic
938130612 2:128712761-128712783 GTAAATAATAGGCATCCTGATGG + Intergenic
938738099 2:134204794-134204816 GCAAACTATATGCTCACTGAGGG - Intronic
939994623 2:148908261-148908283 ATAAAGAATGTGCAGACTGTGGG - Intronic
941026203 2:160458850-160458872 GTAAACTATATGCACAGTTATGG + Intronic
941256034 2:163232077-163232099 GAAAACATTATGCTAACTGAAGG - Intergenic
941468594 2:165858374-165858396 GTAAACAAGATGCTAACTGATGG - Intronic
942357853 2:175138616-175138638 TAAAATAATATGCAAACTGAGGG - Intronic
946131835 2:217612548-217612570 TTAAATAGTTTGCAGACTGAGGG - Intronic
946948487 2:224847128-224847150 GTAAACAATATACTGAATGAAGG + Intronic
1170951920 20:20944657-20944679 CTAAACAATAAGCAGCTTGAGGG + Intergenic
1172400132 20:34643308-34643330 TTAAAAAATATCTAGACTGAGGG - Intronic
1172998865 20:39091377-39091399 GTAATTAATATGCACACTAAAGG + Intergenic
1175564303 20:59960718-59960740 GTAAACGATGTGCAGAGTCAGGG - Intronic
1176699877 21:10033123-10033145 GTAGACAATATGCAGACAAATGG - Intergenic
1178312529 21:31541619-31541641 GGCTACAATATGCAGGCTGATGG + Intronic
1178787456 21:35667048-35667070 GAAAACAAGATTGAGACTGAAGG - Intronic
1178825537 21:36013349-36013371 GAAAACATTATGCTGAGTGAAGG + Intergenic
1180566537 22:16672093-16672115 GTAAACAATATGCAGACTGAAGG - Intergenic
1183787618 22:40039542-40039564 GCAAACAAGCTGCAGAATGAAGG + Exonic
1184517352 22:44970837-44970859 GTAATCAGCATGCAGATTGAAGG - Intronic
1185074332 22:48675243-48675265 GTAAACAAAATGAACTCTGATGG - Intronic
1185305232 22:50111866-50111888 ATCAAAAATAAGCAGACTGATGG - Intronic
950348032 3:12316920-12316942 GTAAGAAATATGCTAACTGATGG + Intronic
951296548 3:20943329-20943351 ATAAAACAGATGCAGACTGAAGG + Intergenic
952985059 3:38771564-38771586 GGAAACAAGACACAGACTGAGGG + Intronic
953160951 3:40418404-40418426 GGAAACAAGATCCAGACTGATGG - Intronic
955989505 3:64611439-64611461 ATAAACACAATGCAGACTGGTGG + Intronic
957450361 3:80373532-80373554 GTTAACAATATGAAGAATGAAGG - Intergenic
958052869 3:88370238-88370260 GTAAACTATATGCATATTCAGGG + Intergenic
959123918 3:102267115-102267137 GTAAACAAATTTCAGACAGAAGG + Intronic
961963063 3:130872273-130872295 TTAAACAATAAGCAGAGTAAGGG - Intronic
962486096 3:135843950-135843972 GTAAACAAGATGCAGGGTCAGGG + Intergenic
966682791 3:182661129-182661151 GTATACATTCTACAGACTGAAGG + Intergenic
971077841 4:23170629-23170651 GTAAAGAATGTGCTGACAGATGG + Intergenic
971413543 4:26401045-26401067 GTACACAAAATGCAGAGGGAGGG - Intronic
976308569 4:83586385-83586407 GTATTCAATAAGCAGACTGAAGG - Intronic
976998865 4:91469700-91469722 TTAAACAATATGCAGAATTATGG - Intronic
977859257 4:101936085-101936107 GGAAACAATAAGCAAAGTGAAGG + Intronic
979067346 4:116155126-116155148 GTAAACTATATGCATATTTAGGG + Intergenic
980235879 4:130106044-130106066 GTAAACAATCAACAGAGTGAAGG - Intergenic
980372287 4:131891731-131891753 GTAGACAATATGCAAACAAATGG - Intergenic
980441633 4:132855091-132855113 GTAATCAATATGAGAACTGATGG - Intergenic
980933865 4:139207750-139207772 GTAAACAATATGCATATTCATGG + Intergenic
981955059 4:150461381-150461403 TTATACAATATGCACAGTGATGG + Intronic
982381564 4:154754509-154754531 GTAAAGAATATGAACACTTAAGG + Intergenic
984745570 4:183212669-183212691 CTAAGAAATATGCAAACTGAGGG + Intronic
986665350 5:10098223-10098245 GTAAACATTATGCTGAGTGTTGG - Intergenic
991220242 5:64206038-64206060 GTATACAATCTGCACACTGAAGG - Intronic
992033485 5:72747768-72747790 GTAAACACTATGCATACAGATGG + Intergenic
993731465 5:91428060-91428082 GTAAATAATTTGCAAACAGAAGG - Intergenic
994617393 5:102121613-102121635 GGTACCAATATGCAGGCTGAGGG - Intergenic
997428337 5:133819782-133819804 ATAAAGAATATTCAGGCTGAGGG + Intergenic
998181134 5:139943899-139943921 ATAAACAATATGCAAACAAATGG + Intronic
998396063 5:141818850-141818872 GGAAACAGTATGCAGGGTGATGG + Intergenic
999031996 5:148304203-148304225 GAAAAGAATATGCATATTGAGGG + Intergenic
1000669397 5:164041739-164041761 GTAGACAATATGAAAACTAATGG + Intergenic
1001508898 5:172303603-172303625 GTAAACTACATGCATATTGAGGG - Intergenic
1004231569 6:13838302-13838324 GTAAACCATGTGCATATTGAGGG - Intergenic
1007205902 6:40150584-40150606 GTAAAGAATAAGAATACTGAAGG - Intergenic
1007440989 6:41860152-41860174 GTCACCAGTATTCAGACTGAGGG + Intronic
1008489514 6:52071420-52071442 GCAAACAAAATGCAGACACAAGG + Intronic
1009547186 6:65034561-65034583 GCAAACAATATGGAGAGTCAGGG - Intronic
1010008263 6:71020349-71020371 GAAAACAATCAACAGACTGAAGG + Intergenic
1010588582 6:77685502-77685524 GGAAACAATCAACAGACTGAAGG - Intergenic
1010938777 6:81891294-81891316 CTGAACAAAATGCACACTGAGGG - Intergenic
1011350267 6:86415297-86415319 ATAAACCATATACAGACTGCTGG - Intergenic
1014295194 6:119609187-119609209 GGAAACAGCATGCAGCCTGAGGG + Intergenic
1015046717 6:128785092-128785114 GTAAACCATATGCATATTCAAGG + Intergenic
1018089262 6:160331545-160331567 GTAAACTATATGCATATTCAGGG - Intergenic
1018409499 6:163529047-163529069 GTAAAAGATAAGCAGACTGATGG + Intronic
1018813384 6:167313922-167313944 GTGGACAATGTGCAGACTGTGGG + Intronic
1018825543 6:167405789-167405811 GTAAACAAGCTGAAGACGGAAGG + Intergenic
1023693897 7:42824813-42824835 ATAAACAAAATGCATACTAAAGG + Intergenic
1024695542 7:51852990-51853012 GTAATCCATATGCATATTGAGGG + Intergenic
1024820351 7:53322204-53322226 GAAAACAGTATGCATAATGACGG - Intergenic
1024960303 7:54967727-54967749 GTAAGGATTATTCAGACTGAAGG + Intergenic
1027492131 7:78841454-78841476 AGAAACAGTGTGCAGACTGAGGG - Intronic
1027704728 7:81514797-81514819 TTGAAAAATATGCAGTCTGACGG - Intergenic
1028835577 7:95371071-95371093 GTAAATATTATGCCAACTGAAGG - Intronic
1030085909 7:105815562-105815584 CTAACCATTATTCAGACTGAGGG + Intronic
1030625161 7:111837684-111837706 GTATAAAATCTGCACACTGAAGG + Intronic
1030686644 7:112493829-112493851 GTAAACAACACAGAGACTGAAGG - Intergenic
1030949885 7:115776935-115776957 GAAAGCAAAATGAAGACTGAGGG + Intergenic
1032240830 7:130157523-130157545 GTCAAGAATATTCAGAATGAAGG - Intergenic
1032573740 7:133029701-133029723 GTGAAGAAAATGCAGACTGGAGG + Intronic
1033298260 7:140161119-140161141 GTAAACTATATGCAGATTATAGG - Intronic
1034701097 7:153096871-153096893 GTAAAGAATATGCAGTTAGAAGG - Intergenic
1037054134 8:14416495-14416517 GTATACAATTAGCAGAGTGAAGG + Intronic
1037246866 8:16845239-16845261 CTAAACAAGATGAAGATTGAAGG + Intergenic
1040965704 8:53078836-53078858 GTAAACTATATGCATATTCAAGG - Intergenic
1042155277 8:65839007-65839029 GAAAACAATATGGAGCATGAAGG - Intronic
1043264457 8:78246350-78246372 GGAAACAATAAACTGACTGATGG - Intergenic
1043878621 8:85515692-85515714 GTACACAATATGTGGAGTGATGG + Intergenic
1044779867 8:95733239-95733261 GTAAGCAAGAGGCAGGCTGATGG + Intergenic
1045216414 8:100153237-100153259 TTAAACATTATTAAGACTGAAGG - Intronic
1046186880 8:110733920-110733942 GTGAGCAATATTCAGACAGAAGG - Intergenic
1049893469 9:92625-92647 GTAAACTATATGCATATTCACGG + Intergenic
1050602549 9:7267391-7267413 GTAAACAAAAGGCAGACTTGAGG - Intergenic
1050638253 9:7637187-7637209 GGAAATAAAATGCAGGCTGAGGG + Intergenic
1050912863 9:11095978-11096000 GTGAAAAATATGCATACTGAGGG - Intergenic
1050922081 9:11216079-11216101 GTAAAAGATATCCAAACTGATGG + Intergenic
1053637022 9:40019589-40019611 GTAGACAATATGCAAACAAATGG - Intergenic
1053734688 9:41092693-41092715 GTAAACTATATGCATATTCACGG + Intergenic
1054317849 9:63616375-63616397 GTAGACAATATGCAAACAAATGG - Intergenic
1054547679 9:66356809-66356831 GTAGACAATATGCAAACAAATGG + Intergenic
1054693692 9:68338704-68338726 GTAAACTATATGCATATTCACGG - Intronic
1057969833 9:99544133-99544155 GTACACAATATGCCTGCTGAAGG + Intergenic
1059662739 9:116417990-116418012 GTTATAAATATGGAGACTGAGGG - Intergenic
1202784889 9_KI270719v1_random:3182-3204 GTAGACAATATGCAAACAAATGG - Intergenic
1203491306 Un_GL000224v1:108059-108081 GTAAACAATTTGTAGCCAGAGGG - Intergenic
1203503930 Un_KI270741v1:49929-49951 GTAAACAATTTGTAGCCAGAGGG - Intergenic
1203583518 Un_KI270746v1:39238-39260 ACAAACAATATGCAGATTGAAGG + Intergenic
1186269462 X:7869480-7869502 ATACACAAAATGCATACTGAGGG - Intergenic
1186302029 X:8210723-8210745 ATAAGTAATATGCAGACTGTGGG + Intergenic
1187474157 X:19595422-19595444 CTCAACAAAATGCAGGCTGAGGG + Intronic
1187512802 X:19937482-19937504 GTAAAGAATGTTCATACTGATGG - Intronic
1188097753 X:26044237-26044259 GTAAATCATCTGCATACTGAAGG - Intergenic
1188812432 X:34667358-34667380 GTAAAAAATAAGAAGACTGAAGG - Intergenic
1189217069 X:39335351-39335373 GTAAGCAATATGCATACTTGTGG - Intergenic
1192247426 X:69385386-69385408 GCAAACATTACGCAGACAGATGG - Intergenic
1193788354 X:85788509-85788531 GCCAACCATATGCAGATTGAAGG + Intergenic
1195203136 X:102568411-102568433 ATTCACAATATACAGACTGAAGG - Intergenic
1197162576 X:123340464-123340486 GTAAATAATTAGTAGACTGAGGG + Intronic
1201433925 Y:13936263-13936285 TTAAACAATATTCAGATTAAAGG - Intergenic