ID: 1154181971

View in Genome Browser
Species Human (GRCh38)
Location 18:12145922-12145944
Sequence TTTGTAGGACCTCCCAAATG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154181966_1154181971 -8 Left 1154181966 18:12145907-12145929 CCCGTTTCTCTTCACTTTGTAGG No data
Right 1154181971 18:12145922-12145944 TTTGTAGGACCTCCCAAATGGGG No data
1154181965_1154181971 -1 Left 1154181965 18:12145900-12145922 CCTGGATCCCGTTTCTCTTCACT No data
Right 1154181971 18:12145922-12145944 TTTGTAGGACCTCCCAAATGGGG No data
1154181968_1154181971 -9 Left 1154181968 18:12145908-12145930 CCGTTTCTCTTCACTTTGTAGGA No data
Right 1154181971 18:12145922-12145944 TTTGTAGGACCTCCCAAATGGGG No data
1154181963_1154181971 22 Left 1154181963 18:12145877-12145899 CCAGGCTGCTTTCTTAAGCGTGT No data
Right 1154181971 18:12145922-12145944 TTTGTAGGACCTCCCAAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154181971 Original CRISPR TTTGTAGGACCTCCCAAATG GGG Intergenic
No off target data available for this crispr