ID: 1154186523

View in Genome Browser
Species Human (GRCh38)
Location 18:12189925-12189947
Sequence CAACATGTCCACACACACCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154186523_1154186528 12 Left 1154186523 18:12189925-12189947 CCTCGGTGTGTGTGGACATGTTG No data
Right 1154186528 18:12189960-12189982 AATGGTGGCTTCCTCCAGAAAGG No data
1154186523_1154186527 -3 Left 1154186523 18:12189925-12189947 CCTCGGTGTGTGTGGACATGTTG No data
Right 1154186527 18:12189945-12189967 TTGGAGGTACAGCATAATGGTGG No data
1154186523_1154186529 13 Left 1154186523 18:12189925-12189947 CCTCGGTGTGTGTGGACATGTTG No data
Right 1154186529 18:12189961-12189983 ATGGTGGCTTCCTCCAGAAAGGG No data
1154186523_1154186534 24 Left 1154186523 18:12189925-12189947 CCTCGGTGTGTGTGGACATGTTG No data
Right 1154186534 18:12189972-12189994 CTCCAGAAAGGGACATTTGGGGG No data
1154186523_1154186531 22 Left 1154186523 18:12189925-12189947 CCTCGGTGTGTGTGGACATGTTG No data
Right 1154186531 18:12189970-12189992 TCCTCCAGAAAGGGACATTTGGG No data
1154186523_1154186526 -6 Left 1154186523 18:12189925-12189947 CCTCGGTGTGTGTGGACATGTTG No data
Right 1154186526 18:12189942-12189964 ATGTTGGAGGTACAGCATAATGG No data
1154186523_1154186533 23 Left 1154186523 18:12189925-12189947 CCTCGGTGTGTGTGGACATGTTG No data
Right 1154186533 18:12189971-12189993 CCTCCAGAAAGGGACATTTGGGG No data
1154186523_1154186530 21 Left 1154186523 18:12189925-12189947 CCTCGGTGTGTGTGGACATGTTG No data
Right 1154186530 18:12189969-12189991 TTCCTCCAGAAAGGGACATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154186523 Original CRISPR CAACATGTCCACACACACCG AGG (reversed) Intergenic
No off target data available for this crispr