ID: 1154186534

View in Genome Browser
Species Human (GRCh38)
Location 18:12189972-12189994
Sequence CTCCAGAAAGGGACATTTGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154186523_1154186534 24 Left 1154186523 18:12189925-12189947 CCTCGGTGTGTGTGGACATGTTG No data
Right 1154186534 18:12189972-12189994 CTCCAGAAAGGGACATTTGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154186534 Original CRISPR CTCCAGAAAGGGACATTTGG GGG Intergenic
No off target data available for this crispr