ID: 1154194278

View in Genome Browser
Species Human (GRCh38)
Location 18:12254430-12254452
Sequence CACGGCAATCAGGGGGACGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 61
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 51}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154194278_1154194285 1 Left 1154194278 18:12254430-12254452 CCCGCGTCCCCCTGATTGCCGTG 0: 1
1: 0
2: 0
3: 9
4: 51
Right 1154194285 18:12254454-12254476 GCTTCCAATCGCCTTGCGTTCGG 0: 1
1: 0
2: 0
3: 1
4: 33
1154194278_1154194286 4 Left 1154194278 18:12254430-12254452 CCCGCGTCCCCCTGATTGCCGTG 0: 1
1: 0
2: 0
3: 9
4: 51
Right 1154194286 18:12254457-12254479 TCCAATCGCCTTGCGTTCGGTGG 0: 1
1: 0
2: 0
3: 2
4: 8

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154194278 Original CRISPR CACGGCAATCAGGGGGACGC GGG (reversed) Intronic
901433832 1:9234585-9234607 CACGGCCACCAGGGGGCCGAAGG + Intergenic
906192644 1:43907896-43907918 GACGGCAAACAGGGAGACACTGG - Intronic
917328412 1:173857079-173857101 CATGGCAATCAGAAGGACACTGG - Intronic
918042542 1:180921992-180922014 CACAGCAATCAGGGCAACGCTGG + Intronic
1067748197 10:48952348-48952370 CACTGTAATCAGAGGGAGGCTGG - Intronic
1068881231 10:62051161-62051183 CACGGCAACCAGGGGAAGGGAGG - Intronic
1079795573 11:24798709-24798731 AATGGCAAGCAGGGGGAAGCAGG - Intronic
1083607704 11:63988640-63988662 CACAGCAATCTGGAGGAGGCAGG - Exonic
1089356618 11:117858133-117858155 GATGGGAAGCAGGGGGACGCTGG - Intronic
1109325540 13:60862989-60863011 CACGGCAATAAGGGAGATGAAGG + Intergenic
1113537860 13:111082377-111082399 CAGGGCAGCCAGGAGGACGCTGG - Intergenic
1128300219 15:66561998-66562020 CATGGCAAAGAGGGGGAAGCTGG - Intronic
1129288648 15:74546197-74546219 CAAAGCAATCAGTGGGAGGCGGG - Intronic
1130024865 15:80262238-80262260 CACGGCAAGAAGGGGGACTTTGG + Intergenic
1132462105 16:60577-60599 CAGGGCAATGAGGGGCACGCAGG + Intronic
1132515133 16:362708-362730 CAAGGCCATCAGAGGGACCCGGG + Intergenic
1136074703 16:27808945-27808967 CCCAGCCATCAGTGGGACGCAGG - Intronic
1136145147 16:28312135-28312157 CACGCCCAACAGGGAGACGCTGG - Intronic
1136402318 16:30025330-30025352 CACGGCCAGCAGGGGCAGGCCGG + Exonic
1138249742 16:55492783-55492805 CAGGGCGGTCAGGGGGCCGCTGG - Intronic
1139603747 16:68003034-68003056 CACGGAAATCACGGGGAAGATGG - Intronic
1139950330 16:70665187-70665209 CAGGGCTATCAGGGGGTCTCTGG + Intronic
1141506561 16:84482103-84482125 CACAGGAAGCAGGGGGAAGCGGG - Intronic
1141689115 16:85586636-85586658 CACGGCAGTCGGGGGGGCGCGGG - Intergenic
1144738825 17:17569860-17569882 CAGGGCAAGCAGGGGGGCTCTGG + Intronic
1151553722 17:74836296-74836318 CACGGCAATGATGGGGAAGTTGG - Exonic
1151729380 17:75901898-75901920 CACGGCATCCAGCGGGACACTGG + Exonic
1153382223 18:4453890-4453912 GGCGGCAAGCAGTGGGACGCTGG - Intronic
1154194278 18:12254430-12254452 CACGGCAATCAGGGGGACGCGGG - Intronic
1157424321 18:47571884-47571906 CAGGGGACTCAGGGGGACTCAGG - Intergenic
1158163043 18:54507635-54507657 CATGGCACTGAGGGGGACGCTGG + Intergenic
1160970495 19:1765795-1765817 CACTGCAGCCATGGGGACGCGGG - Intronic
1163845211 19:19634760-19634782 CAGGACACTGAGGGGGACGCGGG - Intronic
930022736 2:47011386-47011408 CGCGGCCATCAGGGGCACGGTGG - Exonic
935124893 2:100214635-100214657 CACCGCAATCCTGGGAACGCAGG - Intergenic
935406852 2:102718603-102718625 CACGCCAATAAGGGTGCCGCTGG + Exonic
936146104 2:109981523-109981545 CACGGCAGTCAGGGGAAAGCAGG - Intergenic
936198586 2:110389956-110389978 CACGGCAGTCAGGGGAAAGCAGG + Intergenic
944587468 2:201185344-201185366 CAAAGCAATCTGGGGGAGGCAGG - Intronic
948125779 2:235563920-235563942 CATGGCTATCAGTGGGAAGCTGG + Intronic
1174983335 20:55421719-55421741 GACGGCATTCTGGGGGAGGCTGG - Intergenic
1177320520 21:19513915-19513937 CACGGAATTCAGGTGGAAGCAGG - Intergenic
1182347061 22:29673739-29673761 CACGGCCATCAGAGGGACAGGGG - Intronic
950525914 3:13523184-13523206 CACGGGAAGCAGGGGGAAGCTGG - Intergenic
950725430 3:14913999-14914021 CAGGGTAATCAGAGGGATGCAGG - Intronic
962280523 3:134048672-134048694 CACGGCAAACAGGGGAAGGGTGG - Intronic
967015354 3:185476646-185476668 CCCAGCAATCACGGGGACTCAGG + Intronic
992258664 5:74948199-74948221 CACTGCAAACAGGAGGAAGCAGG + Intergenic
1004095217 6:12547560-12547582 GACGGCAATCAGGATGACACTGG + Intergenic
1004426836 6:15512424-15512446 CACGGCACTCACAGGGATGCGGG - Intronic
1006307818 6:33235250-33235272 CACCTCACTCAGGGGAACGCTGG - Intergenic
1019165923 6:170097553-170097575 CACGGGAATCAGGGTCCCGCAGG - Intergenic
1019521952 7:1464845-1464867 CACAGCAATCAGAGGCAGGCTGG - Intergenic
1038320244 8:26519126-26519148 CATGGAAATCAGGGTGAGGCTGG + Intronic
1049261628 8:141642076-141642098 CAGGGCAAGAAGGGGGCCGCAGG + Intergenic
1049565322 8:143335039-143335061 CAGGGAAACCAGGGGGAGGCCGG - Intronic
1056170494 9:83980323-83980345 CACGTCAATCAAGGCGACGGAGG + Intronic
1057727598 9:97579101-97579123 CACGGCAGGCAGAGGGACACTGG - Intronic
1062038445 9:134393057-134393079 CCCGGGAATCATGGGGAAGCGGG + Intronic
1190275767 X:48898167-48898189 CCCGGCAGTCATGGGGACGCTGG + Intronic
1199685655 X:150263053-150263075 CACGGCAACCAGGTGGAGGCAGG - Intergenic