ID: 1154194285

View in Genome Browser
Species Human (GRCh38)
Location 18:12254454-12254476
Sequence GCTTCCAATCGCCTTGCGTT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 35
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 33}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154194283_1154194285 -9 Left 1154194283 18:12254440-12254462 CCTGATTGCCGTGCGCTTCCAAT 0: 1
1: 0
2: 0
3: 4
4: 27
Right 1154194285 18:12254454-12254476 GCTTCCAATCGCCTTGCGTTCGG 0: 1
1: 0
2: 0
3: 1
4: 33
1154194276_1154194285 18 Left 1154194276 18:12254413-12254435 CCTCATCAGGCGAGTGCCCCGCG 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1154194285 18:12254454-12254476 GCTTCCAATCGCCTTGCGTTCGG 0: 1
1: 0
2: 0
3: 1
4: 33
1154194278_1154194285 1 Left 1154194278 18:12254430-12254452 CCCGCGTCCCCCTGATTGCCGTG 0: 1
1: 0
2: 0
3: 9
4: 51
Right 1154194285 18:12254454-12254476 GCTTCCAATCGCCTTGCGTTCGG 0: 1
1: 0
2: 0
3: 1
4: 33
1154194275_1154194285 19 Left 1154194275 18:12254412-12254434 CCCTCATCAGGCGAGTGCCCCGC 0: 1
1: 0
2: 0
3: 7
4: 65
Right 1154194285 18:12254454-12254476 GCTTCCAATCGCCTTGCGTTCGG 0: 1
1: 0
2: 0
3: 1
4: 33
1154194277_1154194285 2 Left 1154194277 18:12254429-12254451 CCCCGCGTCCCCCTGATTGCCGT 0: 1
1: 0
2: 0
3: 4
4: 25
Right 1154194285 18:12254454-12254476 GCTTCCAATCGCCTTGCGTTCGG 0: 1
1: 0
2: 0
3: 1
4: 33
1154194280_1154194285 -6 Left 1154194280 18:12254437-12254459 CCCCCTGATTGCCGTGCGCTTCC 0: 1
1: 0
2: 0
3: 1
4: 75
Right 1154194285 18:12254454-12254476 GCTTCCAATCGCCTTGCGTTCGG 0: 1
1: 0
2: 0
3: 1
4: 33
1154194279_1154194285 0 Left 1154194279 18:12254431-12254453 CCGCGTCCCCCTGATTGCCGTGC 0: 1
1: 0
2: 0
3: 1
4: 48
Right 1154194285 18:12254454-12254476 GCTTCCAATCGCCTTGCGTTCGG 0: 1
1: 0
2: 0
3: 1
4: 33
1154194281_1154194285 -7 Left 1154194281 18:12254438-12254460 CCCCTGATTGCCGTGCGCTTCCA 0: 1
1: 0
2: 0
3: 0
4: 44
Right 1154194285 18:12254454-12254476 GCTTCCAATCGCCTTGCGTTCGG 0: 1
1: 0
2: 0
3: 1
4: 33
1154194282_1154194285 -8 Left 1154194282 18:12254439-12254461 CCCTGATTGCCGTGCGCTTCCAA 0: 1
1: 0
2: 0
3: 6
4: 41
Right 1154194285 18:12254454-12254476 GCTTCCAATCGCCTTGCGTTCGG 0: 1
1: 0
2: 0
3: 1
4: 33

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154194285 Original CRISPR GCTTCCAATCGCCTTGCGTT CGG Intronic
902198052 1:14812771-14812793 ACTTCCAATCCCAATGCGTTGGG - Intronic
903681331 1:25099227-25099249 GCTTCCCCTCGCCTTGTGTATGG - Intergenic
905246230 1:36615987-36616009 GCTTCTTATCGCCTAGCCTTGGG - Intergenic
909563214 1:77027443-77027465 GATTGCAGTCGCCTTGCCTTGGG - Intronic
910727144 1:90351063-90351085 CTTTCCAATCCCCTTGCATTTGG - Intergenic
918164444 1:181931036-181931058 GCTTTGAATGGCCTTGCCTTTGG + Intergenic
924200792 1:241656582-241656604 TCTTCCCATTGCCTTGCTTTTGG + Intronic
1063899772 10:10720335-10720357 GCTTCCTTTCTCCTTGCTTTTGG + Intergenic
1077286313 11:1767563-1767585 GCTTCTAATCCCCTTGCCTCTGG + Intergenic
1105538305 13:21290933-21290955 GCTTCCAATGACCTTGATTTGGG + Intergenic
1112434682 13:99383569-99383591 TCTTCCAAATGCCTTGCGGTGGG - Intronic
1118900517 14:69981716-69981738 GCTTCCAATCTACTTTCCTTTGG - Intronic
1121657391 14:95607210-95607232 TCTCCCAGACGCCTTGCGTTAGG - Intergenic
1131466410 15:92658066-92658088 GCTTCCAGTGGCCTTGAGCTGGG - Intronic
1154194285 18:12254454-12254476 GCTTCCAATCGCCTTGCGTTCGG + Intronic
1167037650 19:47003596-47003618 CTTTCCCATCGCCTAGCGTTTGG + Exonic
931979912 2:67683597-67683619 GCTTCCAAAAGCATTGGGTTAGG + Intergenic
932604956 2:73158966-73158988 ACTTCCACTCCCCTTGAGTTTGG - Intergenic
937245745 2:120491466-120491488 ACTTCCTATCTCCTTGCATTGGG + Intergenic
941861175 2:170282720-170282742 GCTTCCAATCCCCAGGCCTTGGG + Intronic
1176088530 20:63308889-63308911 CTTTCCAATCGCCTGGTGTTTGG + Intronic
951053239 3:18118628-18118650 GCTTCCAATCCAGTTGGGTTAGG + Intronic
956565700 3:70635519-70635541 GCTACCAAACTCCTTGGGTTTGG + Intergenic
964062687 3:152542780-152542802 TCTTCCACTCGCTTTGCTTTTGG - Intergenic
975460556 4:74648453-74648475 GATTTGAATTGCCTTGCGTTTGG - Intergenic
986553464 5:8984372-8984394 GCTGCCAATCTCCTTCCCTTCGG + Intergenic
992086313 5:73281189-73281211 GCCTCCAATCCCCTTGCTTTGGG + Intergenic
1015885449 6:137913003-137913025 CCTTCCAATCTCCCTGCTTTTGG + Intergenic
1019430955 7:999425-999447 GCTTACAATCGGCTTGCAATAGG + Intronic
1021158913 7:17247274-17247296 GCTTCCATTCGCATGGAGTTAGG - Intergenic
1021535299 7:21697289-21697311 GCTTCAAATCCCCTTTCTTTTGG - Intronic
1024426687 7:49233921-49233943 GCTTCCTACCGCCTTAGGTTGGG - Intergenic
1033269753 7:139920183-139920205 GCTTCAAATAGCCATGCCTTGGG - Intronic
1040413942 8:47181121-47181143 GATTCCAATCCCCATGTGTTTGG + Intergenic
1053025679 9:34726405-34726427 GCATCCAATGGCCTTGCATATGG - Exonic