ID: 1154194286

View in Genome Browser
Species Human (GRCh38)
Location 18:12254457-12254479
Sequence TCCAATCGCCTTGCGTTCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 11
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 8}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154194278_1154194286 4 Left 1154194278 18:12254430-12254452 CCCGCGTCCCCCTGATTGCCGTG 0: 1
1: 0
2: 0
3: 9
4: 51
Right 1154194286 18:12254457-12254479 TCCAATCGCCTTGCGTTCGGTGG 0: 1
1: 0
2: 0
3: 2
4: 8
1154194283_1154194286 -6 Left 1154194283 18:12254440-12254462 CCTGATTGCCGTGCGCTTCCAAT 0: 1
1: 0
2: 0
3: 4
4: 27
Right 1154194286 18:12254457-12254479 TCCAATCGCCTTGCGTTCGGTGG 0: 1
1: 0
2: 0
3: 2
4: 8
1154194277_1154194286 5 Left 1154194277 18:12254429-12254451 CCCCGCGTCCCCCTGATTGCCGT 0: 1
1: 0
2: 0
3: 4
4: 25
Right 1154194286 18:12254457-12254479 TCCAATCGCCTTGCGTTCGGTGG 0: 1
1: 0
2: 0
3: 2
4: 8
1154194281_1154194286 -4 Left 1154194281 18:12254438-12254460 CCCCTGATTGCCGTGCGCTTCCA 0: 1
1: 0
2: 0
3: 0
4: 44
Right 1154194286 18:12254457-12254479 TCCAATCGCCTTGCGTTCGGTGG 0: 1
1: 0
2: 0
3: 2
4: 8
1154194275_1154194286 22 Left 1154194275 18:12254412-12254434 CCCTCATCAGGCGAGTGCCCCGC 0: 1
1: 0
2: 0
3: 7
4: 65
Right 1154194286 18:12254457-12254479 TCCAATCGCCTTGCGTTCGGTGG 0: 1
1: 0
2: 0
3: 2
4: 8
1154194282_1154194286 -5 Left 1154194282 18:12254439-12254461 CCCTGATTGCCGTGCGCTTCCAA 0: 1
1: 0
2: 0
3: 6
4: 41
Right 1154194286 18:12254457-12254479 TCCAATCGCCTTGCGTTCGGTGG 0: 1
1: 0
2: 0
3: 2
4: 8
1154194276_1154194286 21 Left 1154194276 18:12254413-12254435 CCTCATCAGGCGAGTGCCCCGCG 0: 1
1: 0
2: 0
3: 2
4: 36
Right 1154194286 18:12254457-12254479 TCCAATCGCCTTGCGTTCGGTGG 0: 1
1: 0
2: 0
3: 2
4: 8
1154194279_1154194286 3 Left 1154194279 18:12254431-12254453 CCGCGTCCCCCTGATTGCCGTGC 0: 1
1: 0
2: 0
3: 1
4: 48
Right 1154194286 18:12254457-12254479 TCCAATCGCCTTGCGTTCGGTGG 0: 1
1: 0
2: 0
3: 2
4: 8
1154194280_1154194286 -3 Left 1154194280 18:12254437-12254459 CCCCCTGATTGCCGTGCGCTTCC 0: 1
1: 0
2: 0
3: 1
4: 75
Right 1154194286 18:12254457-12254479 TCCAATCGCCTTGCGTTCGGTGG 0: 1
1: 0
2: 0
3: 2
4: 8

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154194286 Original CRISPR TCCAATCGCCTTGCGTTCGG TGG Intronic
900302115 1:1983037-1983059 TCCAGCCGCCTTGCGTTTGGCGG - Intronic
920094198 1:203475393-203475415 AACAATCGCCTTGCCTTCTGGGG - Intergenic
1080753941 11:35177393-35177415 TCCAATGGCCTTGCGGTAAGCGG + Intronic
1118601256 14:67472747-67472769 TTCAATCCCCGTGTGTTCGGTGG - Exonic
1154194286 18:12254457-12254479 TCCAATCGCCTTGCGTTCGGTGG + Intronic
1173875936 20:46371570-46371592 TCCTCTCACCTTGCCTTCGGCGG + Exonic
1005626566 6:27668089-27668111 CCCATTCGCCTTCCTTTCGGCGG + Intergenic
1018259400 6:161954448-161954470 TCCATTCGCCTTGCTTTCTGTGG + Intronic
1036637234 8:10559719-10559741 TCCCATCCTCTTGCGTTCTGGGG - Intergenic
1040413943 8:47181124-47181146 TCCAATCCCCATGTGTTTGGTGG + Intergenic
1043109759 8:76166122-76166144 TCCAATTGCCTTGAGTGCAGGGG - Intergenic