ID: 1154194390

View in Genome Browser
Species Human (GRCh38)
Location 18:12254881-12254903
Sequence CTTCCAGGAGGGGCCAAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 303
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 269}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154194390_1154194401 3 Left 1154194390 18:12254881-12254903 CCAGGCTTGGCCCCTCCTGGAAG 0: 1
1: 0
2: 1
3: 32
4: 269
Right 1154194401 18:12254907-12254929 GGGCTCTGGTCTCCGAGGGGAGG 0: 1
1: 0
2: 0
3: 25
4: 220
1154194390_1154194404 20 Left 1154194390 18:12254881-12254903 CCAGGCTTGGCCCCTCCTGGAAG 0: 1
1: 0
2: 1
3: 32
4: 269
Right 1154194404 18:12254924-12254946 GGGAGGCCCCAACCGTCCGGCGG 0: 1
1: 0
2: 1
3: 4
4: 44
1154194390_1154194398 -2 Left 1154194390 18:12254881-12254903 CCAGGCTTGGCCCCTCCTGGAAG 0: 1
1: 0
2: 1
3: 32
4: 269
Right 1154194398 18:12254902-12254924 AGCGCGGGCTCTGGTCTCCGAGG 0: 1
1: 0
2: 0
3: 8
4: 97
1154194390_1154194399 -1 Left 1154194390 18:12254881-12254903 CCAGGCTTGGCCCCTCCTGGAAG 0: 1
1: 0
2: 1
3: 32
4: 269
Right 1154194399 18:12254903-12254925 GCGCGGGCTCTGGTCTCCGAGGG 0: 1
1: 0
2: 0
3: 6
4: 100
1154194390_1154194400 0 Left 1154194390 18:12254881-12254903 CCAGGCTTGGCCCCTCCTGGAAG 0: 1
1: 0
2: 1
3: 32
4: 269
Right 1154194400 18:12254904-12254926 CGCGGGCTCTGGTCTCCGAGGGG 0: 1
1: 0
2: 0
3: 4
4: 95
1154194390_1154194403 17 Left 1154194390 18:12254881-12254903 CCAGGCTTGGCCCCTCCTGGAAG 0: 1
1: 0
2: 1
3: 32
4: 269
Right 1154194403 18:12254921-12254943 GAGGGGAGGCCCCAACCGTCCGG 0: 1
1: 0
2: 1
3: 11
4: 82

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154194390 Original CRISPR CTTCCAGGAGGGGCCAAGCC TGG (reversed) Intronic
900126298 1:1070342-1070364 CGGCCAGGAGGGCCCAGGCCAGG - Intergenic
900373306 1:2342009-2342031 CTGCCAGGAGGTGACAAGCATGG - Intronic
901125203 1:6924288-6924310 CTGCCAGGAGGGGCTCAGGCTGG + Intronic
901219217 1:7573567-7573589 CTTCCAGGAGAGCCTATGCCCGG + Intronic
902338040 1:15765093-15765115 CTCCCAGGGGCGGCCACGCCGGG - Exonic
902388204 1:16088115-16088137 CTCCCAGGAGGTGCCCAGCCCGG - Intergenic
903542090 1:24102223-24102245 CTTTCAGGAGGGGGCCAGGCTGG - Intronic
903746553 1:25590789-25590811 CTTCCAGGATGCGGCAAGCCTGG - Intergenic
903888484 1:26554904-26554926 GTCCCAGGTGGGGTCAAGCCTGG - Intronic
904091827 1:27950251-27950273 CTTCCAGCAGGGGTCAAACCAGG + Intronic
904331593 1:29761392-29761414 CTGGCAGGAGGGCACAAGCCTGG + Intergenic
904364104 1:29999632-29999654 GGTCAAGGAGGGGCCAAGGCTGG - Intergenic
904583686 1:31566751-31566773 CTTCCAGGAGGGGCCTCCCTGGG - Intergenic
907808384 1:57843924-57843946 CTTCCAGAATGGGTCAAACCTGG - Intronic
911618042 1:100036830-100036852 ATTCCAGGAGTGGCTAAGCTAGG + Intergenic
914755290 1:150558797-150558819 CTTCCATGAGGGGCCCGGCTAGG + Intronic
914984134 1:152441882-152441904 CTACCAGGAGGTGCCAGGGCTGG - Intergenic
915331011 1:155112344-155112366 GTCCCAGGAGGGGCCATGGCAGG + Intergenic
915444234 1:155965734-155965756 CATCCGGGAGCGGCCAAGCTCGG - Exonic
915589930 1:156864887-156864909 TTGCGAGGAGGGCCCAAGCCTGG + Intronic
916479482 1:165202196-165202218 CATCCAGGAGGGGCCAGGATAGG - Exonic
917956159 1:180101003-180101025 CTTCCAGTAGGTGCCAAACAGGG + Intronic
918078058 1:181185431-181185453 CTTCCAGGAGGAGGCAATGCTGG + Intergenic
920306880 1:205024166-205024188 ATTTCAGGAGGAGCCAGGCCTGG - Intergenic
921574240 1:216815591-216815613 CTACCAGGTGCAGCCAAGCCAGG - Intronic
921755543 1:218851863-218851885 CTCAGAGGAGGGGCCCAGCCAGG - Intergenic
924624775 1:245688908-245688930 CTGCAAGGAGAGGCCAGGCCTGG - Intronic
1062982641 10:1737758-1737780 CCTCCAGGAGGGACCCTGCCCGG + Intergenic
1063383932 10:5604189-5604211 CTTCCTGGAGACGCCAAGACTGG + Intergenic
1065298823 10:24302313-24302335 AATCCAGGAGTGGCCAACCCAGG - Intronic
1067088047 10:43253143-43253165 CCTGCAGGAGGGGCCTGGCCAGG + Intronic
1070653387 10:78254080-78254102 CTTCCTGGAGGGGCCCATGCTGG + Intergenic
1072462343 10:95631197-95631219 CTTCCTGGAGGGGCCACTCTTGG - Intronic
1072618570 10:97065442-97065464 CTTCAAGGAGGTGGTAAGCCTGG + Intronic
1074922051 10:118024692-118024714 CTTCCATGAGGGTGCAAGCAAGG + Intronic
1076835023 10:133016679-133016701 CATCCAGGGCGGGCCCAGCCAGG + Intergenic
1077062831 11:625311-625333 CTTAGGGGAGGAGCCAAGCCAGG - Intronic
1077170995 11:1165646-1165668 CTGCCAGGAGGTTCCATGCCCGG + Exonic
1077461903 11:2714962-2714984 CCTGCAGGAGGGGCCTAGCCAGG + Intronic
1077466962 11:2738039-2738061 CTGCTGGGAGGGGCCGAGCCTGG + Intronic
1078742561 11:14080791-14080813 CCTTCATGAGGGGCCAAGCATGG + Intronic
1079313065 11:19383270-19383292 TTGGGAGGAGGGGCCAAGCCTGG - Intronic
1083665227 11:64270456-64270478 CTCCCAGGAGGCTCCACGCCGGG + Intronic
1083718052 11:64590547-64590569 AATCCACCAGGGGCCAAGCCTGG - Intergenic
1083844208 11:65321555-65321577 GTCCCAGGTGGGGCCCAGCCAGG + Exonic
1083925067 11:65801140-65801162 CCTGCAGGAGGGGCCAAGGGCGG + Intergenic
1084120540 11:67066479-67066501 CCTCCAGGCGGTGCCAGGCCTGG + Intronic
1084256452 11:67946315-67946337 CCTCCTGGAGGGGCCTGGCCAGG - Intergenic
1084389011 11:68862697-68862719 GTTCCTGGAGGGGCCAGCCCAGG + Intergenic
1084464041 11:69311971-69311993 CTCCCTGGAGGGGCCAGGCTTGG - Intronic
1084709352 11:70834475-70834497 CAGCCAGCGGGGGCCAAGCCAGG + Intronic
1085308386 11:75501220-75501242 GTGCGAGGAGGGGCCGAGCCAGG - Intronic
1085389376 11:76174847-76174869 CAGGCGGGAGGGGCCAAGCCAGG - Intergenic
1086071318 11:82803106-82803128 GTTCCAGGAGAGACCAAGCTTGG + Intergenic
1086399163 11:86446733-86446755 CCTCCTGGTGGGGCCAACCCAGG + Intronic
1086808932 11:91280452-91280474 CTGCAAGGTGGGGCAAAGCCTGG + Intergenic
1087181813 11:95149709-95149731 CTTCAGGGAGGAGCCAAGGCTGG + Intergenic
1087906283 11:103701519-103701541 CTTCCAGGAGGTGGCATGGCTGG - Intergenic
1088367905 11:109058318-109058340 CTTCCAGGGGGCCCCAAACCTGG + Intergenic
1088528314 11:110780530-110780552 CTTCCAGTGGGGGACATGCCAGG + Intergenic
1089100209 11:115956749-115956771 CTTCCGGAAGGGGCCAGCCCGGG + Intergenic
1090398547 11:126434477-126434499 CTGCCAGGAGGGGCAGAGGCAGG + Intronic
1091705706 12:2691651-2691673 CTTCCAGGAGGACCCCAACCCGG + Intronic
1093117032 12:15223525-15223547 TTTCGAAGAGGGCCCAAGCCAGG + Intronic
1093896193 12:24577100-24577122 TTTACAGCAGGGGCCAAGGCTGG - Intergenic
1096178379 12:49538041-49538063 CTTCCCGGCGGGGCGGAGCCGGG - Intergenic
1096604116 12:52752807-52752829 CTTCAAGCGGGGGCCAAGACAGG - Intergenic
1097057891 12:56261016-56261038 CTTCCAGGAAGGGCTAAACTAGG + Intergenic
1100992673 12:100267365-100267387 CTTCCAGGAGGGGCGGTGCTGGG - Exonic
1101512747 12:105407600-105407622 CTTCCTTCAGGGGCCTAGCCTGG - Intergenic
1101769631 12:107737133-107737155 CTTACAGGAAGGGCAAAGCCAGG + Intronic
1102173033 12:110856470-110856492 CTTCCAGGAGGGGCTTAAGCAGG + Intronic
1102556966 12:113733128-113733150 CTTCCAGGTGGGCACAACCCTGG - Intergenic
1103049126 12:117763932-117763954 CTTCCATGATGGGCCAAGGAAGG + Intronic
1103536596 12:121637747-121637769 CTTCCAGGTGTGGGCAGGCCTGG + Intronic
1103685724 12:122730578-122730600 CCTCTGGGAGAGGCCAAGCCTGG + Exonic
1103723968 12:122988873-122988895 CTGCCAGGAGGGGCCGTGACTGG + Intronic
1104062815 12:125282349-125282371 CTTGCAGAAGAGGACAAGCCTGG - Intronic
1104477986 12:129085708-129085730 CTACCAGGAAGGGCAGAGCCAGG + Intronic
1104505502 12:129328078-129328100 GCTCCAGGAAGGGCCCAGCCTGG - Intronic
1105650736 13:22374195-22374217 TTTCCAGGAGAGGCCAGCCCTGG - Intergenic
1105699568 13:22926342-22926364 CTTCCAGGAAGGGCCTGGGCCGG + Intergenic
1106401689 13:29437121-29437143 CGTCCAGCAGGGGCCATGACAGG + Intronic
1110163427 13:72407511-72407533 TTGCCAGGATGGGCCAATCCTGG - Intergenic
1113437596 13:110306105-110306127 CTTCCAGCCGTGGACAAGCCTGG - Intronic
1114663394 14:24365215-24365237 CTTACTGGAGGAGCCAAGCCTGG + Intergenic
1115314805 14:32014450-32014472 CATGCTGGAGGGGCCAAGGCTGG + Intronic
1115570074 14:34658114-34658136 CCTCCAGAAGGGGCCAAGCGCGG + Intergenic
1115822116 14:37223789-37223811 CACCCAGGAGGGGCCAGGCAGGG - Intronic
1121279056 14:92686904-92686926 CTTCCAGGAGGGGAAAAGCCCGG - Intronic
1121896061 14:97648948-97648970 TTTCCAGCACAGGCCAAGCCTGG - Intergenic
1122088674 14:99323772-99323794 CACCCAAGAGGGACCAAGCCGGG + Intergenic
1123690742 15:22836854-22836876 TTTCCAGGAGGAGCCAAGGCAGG + Intergenic
1124037860 15:26072898-26072920 CTTGGAGGAGTGGCCAAGCCTGG - Intergenic
1124149684 15:27166538-27166560 CTTCATGCATGGGCCAAGCCAGG - Intronic
1125393782 15:39225308-39225330 CTTCCCTGCAGGGCCAAGCCTGG + Intergenic
1127771107 15:62231542-62231564 GTACCAGGAGAGGCCATGCCTGG - Intergenic
1128105682 15:65043016-65043038 CTTCCCGGAGGTGGCCAGCCTGG + Intergenic
1129698933 15:77756560-77756582 CATCAAGGGAGGGCCAAGCCGGG + Intronic
1129788384 15:78324008-78324030 CCTCCAGAAGGTGCCAAGCACGG - Intergenic
1130649243 15:85752656-85752678 CTTCCAGAGGAGGCCAGGCCAGG - Intergenic
1131973062 15:97911840-97911862 CTCCCTGGAGGGGCTAAGCACGG - Intergenic
1132994379 16:2815379-2815401 CTTCCCGCAGAGGCCAAGCCTGG - Intergenic
1133371586 16:5249344-5249366 CCTCCTGGAGGGGCCTGGCCGGG + Intergenic
1135663468 16:24316366-24316388 CTTGAAGGACAGGCCAAGCCTGG - Intronic
1136994325 16:35177861-35177883 CATCCAGGAGGGGACAAAGCTGG - Intergenic
1137613256 16:49833099-49833121 GTCCCATGAGGGGCCAGGCCTGG - Intronic
1138191253 16:55015996-55016018 CTTCCACGAGGGGCAGAGTCAGG + Intergenic
1138457868 16:57131713-57131735 GGGCCAGGAGGGGCCAGGCCTGG - Intronic
1140551443 16:75870435-75870457 ATTCCAGGAGGTGCCAAGGGAGG + Intergenic
1141271496 16:82544992-82545014 CTTCCATGAGGGTCTAAGCAGGG + Intergenic
1141301401 16:82819493-82819515 CTTCCCAGTAGGGCCAAGCCTGG - Intronic
1141665704 16:85464091-85464113 CAGCCAGGAGGGGCCAGGCATGG - Intergenic
1141780631 16:86158012-86158034 TTTCCAGGAGGGGAGAAGCTGGG - Intergenic
1141842060 16:86579564-86579586 CTCCTAGGGGGTGCCAAGCCTGG + Exonic
1142005207 16:87686483-87686505 CTTCCTGGAGGGCTCAATCCTGG + Intronic
1142187319 16:88700818-88700840 CTGCCAGGAGGGCCAGAGCCGGG - Intronic
1142757558 17:2024964-2024986 CGTCGAGGCGGGGGCAAGCCGGG + Exonic
1142880432 17:2879089-2879111 CTTGGAGGTGGGGCCAAGCCAGG - Intronic
1143102997 17:4514347-4514369 CTCCCAGGAGGGCCCAGGCAGGG - Intronic
1143282171 17:5763038-5763060 CTTCCTTGAGGTGCCCAGCCTGG - Intergenic
1144075721 17:11717539-11717561 CTTCCAGGCGGGGCCATGTGAGG - Intronic
1145909627 17:28534949-28534971 GGTCCAGGAGGGGCCAGGCCTGG - Exonic
1148157078 17:45430726-45430748 CTTCCAGGCGGGACAGAGCCGGG - Intronic
1151570314 17:74922610-74922632 CTTCCAGGGGGACCCCAGCCAGG + Intronic
1151756357 17:76077364-76077386 CTGCCAGGACGGGCCAGGACAGG - Exonic
1151965008 17:77426549-77426571 GTTCCAGGAGCAGCCAGGCCAGG - Intronic
1152773756 17:82187462-82187484 CTTACAGGAGGTCCCCAGCCCGG + Intronic
1153316386 18:3726800-3726822 CTTGCAGGGGCAGCCAAGCCTGG + Intronic
1154194390 18:12254881-12254903 CTTCCAGGAGGGGCCAAGCCTGG - Intronic
1155508749 18:26556208-26556230 CTTCCATCAGGTGCAAAGCCTGG - Intronic
1157196575 18:45624778-45624800 TTTCCAGGAGGGGCAGAGCTGGG - Exonic
1157333068 18:46717247-46717269 CTTCCCAGAGGGGCCATGCTCGG + Intronic
1157386702 18:47263938-47263960 CACCCAGGAAGGGCGAAGCCCGG - Intergenic
1160123664 18:76151635-76151657 CTTGCAGGAGGCGCCTGGCCTGG - Intergenic
1160554109 18:79714997-79715019 CTCCCCGGAGAGGCCGAGCCTGG + Exonic
1161227144 19:3151942-3151964 CTTCAAGGAGCTGCCAAGCTAGG + Intronic
1162029224 19:7910170-7910192 CTCCCAGGATGGGTCCAGCCTGG - Intronic
1163737093 19:18988201-18988223 GTTCCCTGAGGGGCCCAGCCAGG - Intergenic
1166644546 19:44521974-44521996 CGTGCAGGATGTGCCAAGCCAGG + Intronic
1166854822 19:45778276-45778298 CTGCCCGGAGGGGCGGAGCCTGG - Intronic
1167503565 19:49860288-49860310 ACTCCTGGAGGGGCCCAGCCCGG - Exonic
1167641936 19:50687027-50687049 CTTCCAGGGGGAGACTAGCCCGG + Intronic
1167781450 19:51601559-51601581 CGTCCAGGAGGGAGCAGGCCTGG - Intergenic
1168287645 19:55342431-55342453 CTGCCAGGCGGGACCAGGCCCGG - Intronic
925023226 2:588016-588038 CTTCCAGGAGGGGCAGGGCCAGG + Intergenic
925586127 2:5466065-5466087 TCTCCAGAAAGGGCCAAGCCAGG - Intergenic
927706863 2:25301790-25301812 CCCCAAGGAGGGGCCAACCCAGG + Intronic
928312067 2:30219421-30219443 CTTCCAGGAGGGCCCAAATCTGG - Intergenic
930007648 2:46910747-46910769 CTTCCAGGATAGGCCAGGCATGG + Intronic
931549252 2:63424458-63424480 CTTGCAGGAGTGGCCAAGCGGGG - Intronic
932067039 2:68575202-68575224 CTTGGAGGAGGGAGCAAGCCAGG + Intronic
932102841 2:68916384-68916406 CCTCCAGGAGGGAGAAAGCCAGG + Intergenic
932319725 2:70812800-70812822 CTCCCAGGAGTGCCCAAGCCAGG - Intronic
932416872 2:71578854-71578876 CCTTCTGCAGGGGCCAAGCCTGG + Intronic
933400178 2:81786253-81786275 CTTCCAGCTGGTACCAAGCCTGG - Intergenic
933559276 2:83872071-83872093 GATCCAGGAGTGGCCAACCCAGG + Intergenic
934040898 2:88126731-88126753 CTTGCAGGAGGGACCTAGCTTGG - Intronic
936076510 2:109404951-109404973 CTGGCAGGAGGGGCCAGGACGGG - Intronic
938448498 2:131395244-131395266 CTTCCAGGAGCGGCCAGCGCAGG + Intergenic
940213305 2:151278205-151278227 CTTCTAGGAAGGGACAAGGCTGG + Intronic
942458978 2:176156752-176156774 CTTGAAGAAGGGGCCAAGACAGG + Intronic
944611491 2:201413349-201413371 CTTCCAGGAGGGGCAGAACTGGG + Intronic
945059859 2:205899589-205899611 CTTCCAGGAGAATCCAAACCAGG - Intergenic
945194590 2:207226464-207226486 CTTCCTGTAGGTGCCAGGCCTGG + Intergenic
946306822 2:218860821-218860843 CTTCTAGCTAGGGCCAAGCCTGG - Intronic
948355119 2:237371816-237371838 CTTCCGGGAGCTGCCCAGCCTGG - Exonic
1168994782 20:2125023-2125045 CATCCATGAGGGGACAGGCCTGG + Intronic
1169368346 20:5009384-5009406 GTTCCAGGAGAGGCCAAGGTGGG - Intronic
1170554482 20:17504545-17504567 CTTCCAGGAGGAGGCAGGACCGG + Intronic
1170665741 20:18384649-18384671 GGACCAGGAGGGGCCCAGCCTGG - Intronic
1172763183 20:37336379-37336401 CTTCCAGGAGGGGCCGGGGTTGG + Intergenic
1173326705 20:42040293-42040315 CTTACTGGAGGGGCCACACCGGG + Intergenic
1173681698 20:44886337-44886359 CATCCAGGAGGAGCCAAACACGG - Intronic
1174181745 20:48679491-48679513 CTTCCAGGACGGGGCAGGGCAGG + Intronic
1175511069 20:59526443-59526465 CATCCAGGTGGGGTCCAGCCTGG + Intergenic
1175526739 20:59639446-59639468 GTTCCAAGAGGGGACAAGCATGG + Intronic
1175837376 20:62004763-62004785 CTGCCACGAGGGGCCCAGCAGGG - Intronic
1175965467 20:62658077-62658099 CTTCCCGGGAGAGCCAAGCCAGG - Intronic
1176075686 20:63247345-63247367 CCCCCAGGCGGGGCCAACCCAGG - Intronic
1176241847 20:64079112-64079134 TTCCCTGGAGGGGCCAGGCCAGG - Intronic
1176416013 21:6475188-6475210 TTTCCATGAGGGGCCACTCCTGG + Intergenic
1179691513 21:43083522-43083544 TTTCCATGAGGGGCCACTCCTGG + Intergenic
1180655660 22:17418802-17418824 CTTCCACGTGGGGCCCAGCCCGG + Intronic
1181559319 22:23690884-23690906 GTCCCAGGAGGGGCCCAGGCAGG - Exonic
1181751246 22:24990679-24990701 CTTCAAGGAAGGGCAAGGCCAGG - Intronic
1181839616 22:25645381-25645403 CTCCCAGAAGCAGCCAAGCCTGG - Intronic
1182062434 22:27407646-27407668 CTCCCAGCAGGGGCCTGGCCAGG + Intergenic
1184691503 22:46119400-46119422 AGTCCAGGAAGGGCCCAGCCAGG + Intergenic
949105827 3:198242-198264 CTTCGAGGAGGGGCTGAACCTGG - Intronic
950316196 3:12004216-12004238 CTTGCAGGAGGGGGCGACCCAGG - Intergenic
950490411 3:13301348-13301370 CTTCCAGGAGGGGCGTGGCAGGG - Intergenic
950791897 3:15478732-15478754 CTTCCGGGGGCTGCCAAGCCTGG - Intronic
953412542 3:42698428-42698450 CTTCCCACAGGGGCCCAGCCTGG + Intronic
953432025 3:42847785-42847807 GTTCCAGGAAGGGCTGAGCCTGG - Intronic
953891629 3:46755737-46755759 CTTCCAGGTGCTTCCAAGCCTGG + Intronic
953906046 3:46868712-46868734 CTTCCAGAATGGACCAAGCCTGG - Intronic
954708837 3:52495150-52495172 ATGCCAGGAGGGTCCCAGCCGGG + Intergenic
955112149 3:55959880-55959902 CTTCCAGGAGGGTTCAAAGCAGG + Intronic
955407159 3:58632836-58632858 CTTCCACCAGGGGCCACGGCAGG - Intergenic
956420979 3:69085829-69085851 CTTCCAGCAGTGGCCAGGCGTGG + Intronic
957386218 3:79500418-79500440 CTTGCGGCTGGGGCCAAGCCCGG - Intronic
958892113 3:99794703-99794725 CTGCCAGGAGTGGGCAAACCAGG + Exonic
959598517 3:108153393-108153415 CTTCCGGGAGGGGGCCAGGCTGG - Intergenic
960556276 3:119034488-119034510 CTTCCCGGTGGGGCCAGGCCGGG - Intronic
960987483 3:123290321-123290343 CTTCCAGGAGGGCCGGGGCCAGG - Intronic
961175721 3:124833656-124833678 CATCCAGGATGGGACAAGCTTGG + Intronic
961495083 3:127285406-127285428 CTTCCAGGAGGAAAAAAGCCTGG + Intergenic
962743126 3:138377667-138377689 CTTCGGGGAGGTGCTAAGCCTGG + Intronic
966712724 3:182986014-182986036 CATCTAGGAGTGGCCAAGCTGGG - Intergenic
966806954 3:183815300-183815322 CTGCCAGGAAGGGGCAGGCCCGG + Intergenic
968579717 4:1384205-1384227 CTTCCTGGGGGAGCCATGCCAGG + Intronic
969014967 4:4098004-4098026 CCTCCTGGAGGGGCCTGGCCAGG - Intergenic
969444187 4:7234823-7234845 CTGCCTGGAGGGGCACAGCCTGG - Intronic
970178733 4:13365374-13365396 ATTCCAGGAGGAGGTAAGCCAGG - Intronic
971258017 4:25031124-25031146 CTTGGGGGAGGGGCCAAGCCTGG + Intergenic
971503270 4:27339613-27339635 ATTCCAGGAAGTGCCAAGCCGGG - Intergenic
971819163 4:31530029-31530051 CTGCCAGAAGGGCCCAAGCCAGG + Intergenic
972548102 4:40100992-40101014 CTTCTAGGGAGAGCCAAGCCTGG + Intronic
977693818 4:99946351-99946373 CCTCCAGGAGGGGCCGAGGTGGG + Intronic
979558272 4:122075658-122075680 CTCCCTGTTGGGGCCAAGCCAGG + Intergenic
982091488 4:151883615-151883637 GTTCCAGCAGAGGCCAGGCCTGG - Intergenic
984338558 4:178423875-178423897 CATTCAGAAGGAGCCAAGCCAGG + Intergenic
985566424 5:620650-620672 CTTCCAAGTGGGGCAAAACCAGG - Intronic
985623195 5:966890-966912 CTTCCCTGAGAGGCCAAGGCAGG - Intergenic
985995040 5:3593064-3593086 CTACCAGGAGGGGCTGAGCCAGG + Intergenic
985995119 5:3593463-3593485 TCTCCAGGTGGGGCCCAGCCAGG + Intergenic
996650834 5:125873871-125873893 CTTCCTGGAGAGGCCTGGCCAGG - Intergenic
997822366 5:137077630-137077652 CCTCCAGGAGAGGCTAAGTCTGG - Intronic
998177783 5:139912375-139912397 GTCCCAGGAGCAGCCAAGCCTGG - Intronic
998521733 5:142807335-142807357 TTGCCAGAAGGGGCCAAGCCAGG + Intronic
998857449 5:146406943-146406965 CTATCAGCAGGGGCCAAGCAGGG + Intergenic
999213891 5:149915467-149915489 TTTTCAGGAAGTGCCAAGCCTGG + Intronic
999378574 5:151104189-151104211 CCTCCAGGAGGACCCAACCCAGG + Intronic
999873419 5:155775739-155775761 CTTCTATGAGGTGCCAAGCCTGG + Intergenic
1000429138 5:161129950-161129972 CTTGCAGTAGGGGCCAGGGCTGG + Intergenic
1001665805 5:173432879-173432901 CTTCCATGAGTCTCCAAGCCTGG - Intergenic
1001790059 5:174448383-174448405 CTTCCAGGAGTGAGCAAGCCTGG - Intergenic
1002174009 5:177391255-177391277 CTGGCAGGAGGGACAAAGCCAGG - Intronic
1002272245 5:178080208-178080230 TCTCCAGGAGGGGCCAGGCCTGG - Intergenic
1004619981 6:17323636-17323658 CTTCGTAGAGGGGCCGAGCCAGG + Intergenic
1006395203 6:33782710-33782732 CTTCCAGTAGACCCCAAGCCGGG + Intronic
1006523105 6:34583492-34583514 CTTGCAGGGGAGGCCAGGCCAGG + Intergenic
1007605283 6:43113590-43113612 CTTCCAGAAAGGGCCAGGCCCGG - Intronic
1008373520 6:50764663-50764685 CCTCCAGGAGGCGTCTAGCCTGG - Intronic
1013667879 6:112366713-112366735 CATCCAGGAGCAGCCCAGCCAGG - Intergenic
1017981080 6:159401643-159401665 AATCCAGGAGTGGCCAACCCAGG - Intergenic
1019147198 6:169983093-169983115 CTTCCAGGAGGGGCTGGGCAGGG - Intergenic
1019152555 6:170018648-170018670 CTTCCAGGAGGGAACAGCCCAGG + Intergenic
1022175659 7:27869639-27869661 CATCCAGGACGGGGCAGGCCAGG + Intronic
1023053423 7:36272957-36272979 CTCCCAGGAGGGGCCGGGGCTGG - Intronic
1026036425 7:66833228-66833250 TCTCCAGGGGTGGCCAAGCCAGG + Intergenic
1026037494 7:66840140-66840162 TCTCCAGGGGTGGCCAAGCCAGG + Intergenic
1026708699 7:72717528-72717550 GATCCAGGAGTGGCCAACCCGGG - Intronic
1029448873 7:100629517-100629539 CATCCAGGAAGGGCCAAGTGGGG - Intronic
1030475371 7:110026078-110026100 ATTCCAGGAGGGGTCCAGCTGGG + Intergenic
1030715144 7:112800704-112800726 AATCCAGGAGTGGCCAACCCAGG - Intergenic
1031118276 7:117691823-117691845 CTACCAGGAAGGGACAAGGCTGG - Intronic
1032745230 7:134779584-134779606 CTTCTGGGAGGGGCCAAGGAAGG + Intronic
1035011858 7:155725616-155725638 GTTTCAGGAGGGGCCATGGCAGG + Intronic
1036256743 8:7212432-7212454 CTTCCTGGAAGGGCCTGGCCAGG - Intergenic
1036308793 8:7671034-7671056 CTTCCTGGAAGGGCCTGGCCAGG - Intergenic
1036360748 8:8075077-8075099 CTTCCTGGAAGGGCCTGGCCAGG + Intergenic
1036890220 8:12591895-12591917 CTTCCTGGAAGGGCCTGGCCAGG - Intergenic
1037818703 8:22125311-22125333 CTTCCCGCTGGGCCCAAGCCAGG + Exonic
1037920682 8:22803316-22803338 CTCCCAGGAGAGGCCAAGACAGG - Intronic
1038862862 8:31406445-31406467 CTTCCTGGTGGGGCAGAGCCAGG + Intergenic
1042226503 8:66518974-66518996 CGTCCGGGAATGGCCAAGCCTGG + Intergenic
1042375028 8:68040314-68040336 ATTCTAGGTGGGGCCAAGCACGG - Intronic
1045236697 8:100358485-100358507 TTTCCATAAAGGGCCAAGCCAGG + Intronic
1047255194 8:123208703-123208725 CATACAGGAGGGGCCAGGCGTGG + Exonic
1048287187 8:133151044-133151066 CTTCCTAGAGAGGCCAAGGCAGG - Intergenic
1048974317 8:139662556-139662578 CCAGCAGAAGGGGCCAAGCCTGG - Intronic
1049203087 8:141351290-141351312 CCTCCAGGAGAGGCCCAGCTGGG + Intergenic
1049211572 8:141389021-141389043 CCTACAGGAGGGGCCCAGGCTGG - Intergenic
1055594544 9:77851680-77851702 CTTCCAGTAGGGTCCTATCCTGG + Intronic
1056116797 9:83448532-83448554 CTTCCAGGGGTGGCCAATACAGG + Intronic
1056852423 9:90095735-90095757 CTTCCGGGAGGGAACAAGCCTGG - Intergenic
1057350422 9:94292702-94292724 CTTAGAGGAGGAGCCCAGCCAGG - Intronic
1057415974 9:94862596-94862618 CTTGCAGGAGGGGCAGAACCTGG - Intronic
1057573459 9:96220872-96220894 CTTCTAGGAGGGGCTGAGGCAGG + Intergenic
1060186053 9:121564808-121564830 CTAACAGGAGGGTCCAGGCCAGG - Intergenic
1060550929 9:124485156-124485178 TTTCTAGGAGGTGCCCAGCCTGG + Intronic
1060922955 9:127435527-127435549 CCTCAAGGAGGGGTCAAGCCAGG - Intronic
1061677511 9:132226750-132226772 CTCCCAGGAGGGGCCCAGGAGGG - Intronic
1061908620 9:133711419-133711441 CTTCAAGGAAGGGCCAATTCAGG - Intronic
1061918908 9:133771607-133771629 CTTCCAGCTGGGGCCTGGCCGGG - Intronic
1062190093 9:135243530-135243552 CTTTCACCAGGGTCCAAGCCTGG + Intergenic
1062194658 9:135266281-135266303 CTTCCAGGAGGAGGCAGCCCAGG - Intergenic
1062522506 9:136964111-136964133 CTTCCAGGGGGGACCATCCCAGG + Intergenic
1062560802 9:137141035-137141057 AATCCAGGAGGGGCCATTCCTGG + Intronic
1203776373 EBV:75424-75446 CTTCGAGGAGGTGCCGAGCCTGG - Intergenic
1185762851 X:2701509-2701531 CTCCCAGGAGGGGCCCTCCCTGG + Intronic
1187757153 X:22540478-22540500 ATTCCATGAGGGGAAAAGCCAGG + Intergenic
1190291198 X:48993482-48993504 CATCCACGAGGGGCCCAGCTTGG + Exonic
1190760617 X:53434784-53434806 CTTCCAGGAGGGCACAGTCCAGG + Intergenic
1192431243 X:71113408-71113430 CCTCCAGAAGGGACCAACCCTGG - Intergenic
1192436847 X:71148412-71148434 TTGCCAGGAGGGGCCTGGCCCGG + Intronic
1194980890 X:100439193-100439215 CACCTAGGAAGGGCCAAGCCTGG + Intergenic
1195702532 X:107716106-107716128 CTTCCTGCAGGGGCCAAGGAAGG - Intronic
1197746607 X:129935758-129935780 CTCCCAGGTGGGGACCAGCCAGG + Intergenic
1200046722 X:153407106-153407128 CATCCAGGTGGGGACATGCCAGG + Intergenic
1200536361 Y:4402668-4402690 GTTCCAGGAGGGGCCAAATGCGG - Intergenic