ID: 1154194442

View in Genome Browser
Species Human (GRCh38)
Location 18:12255025-12255047
Sequence CAGGGGGGACAAGGGGCGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 564
Summary {0: 1, 1: 0, 2: 2, 3: 41, 4: 520}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1154194427_1154194442 4 Left 1154194427 18:12254998-12255020 CCAAGGGCGGAGACGCTGCCTGG 0: 1
1: 0
2: 2
3: 9
4: 172
Right 1154194442 18:12255025-12255047 CAGGGGGGACAAGGGGCGGGTGG 0: 1
1: 0
2: 2
3: 41
4: 520
1154194425_1154194442 13 Left 1154194425 18:12254989-12255011 CCTCCGGGTCCAAGGGCGGAGAC 0: 1
1: 0
2: 1
3: 9
4: 59
Right 1154194442 18:12255025-12255047 CAGGGGGGACAAGGGGCGGGTGG 0: 1
1: 0
2: 2
3: 41
4: 520
1154194426_1154194442 10 Left 1154194426 18:12254992-12255014 CCGGGTCCAAGGGCGGAGACGCT 0: 1
1: 0
2: 1
3: 5
4: 67
Right 1154194442 18:12255025-12255047 CAGGGGGGACAAGGGGCGGGTGG 0: 1
1: 0
2: 2
3: 41
4: 520
1154194423_1154194442 18 Left 1154194423 18:12254984-12255006 CCTTGCCTCCGGGTCCAAGGGCG 0: 1
1: 0
2: 1
3: 1
4: 68
Right 1154194442 18:12255025-12255047 CAGGGGGGACAAGGGGCGGGTGG 0: 1
1: 0
2: 2
3: 41
4: 520
1154194420_1154194442 21 Left 1154194420 18:12254981-12255003 CCTCCTTGCCTCCGGGTCCAAGG 0: 1
1: 0
2: 0
3: 18
4: 140
Right 1154194442 18:12255025-12255047 CAGGGGGGACAAGGGGCGGGTGG 0: 1
1: 0
2: 2
3: 41
4: 520

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1154194442 Original CRISPR CAGGGGGGACAAGGGGCGGG TGG Intronic
900227656 1:1540492-1540514 CCGGGGGGAGGAGGCGCGGGGGG + Intergenic
900472401 1:2861299-2861321 CAGGAGGGACACAGGGCGTGGGG + Intergenic
900578214 1:3394521-3394543 GAGTGGAGCCAAGGGGCGGGCGG + Intronic
901066344 1:6496498-6496520 CTGCATGGACAAGGGGCGGGCGG - Exonic
901473279 1:9472436-9472458 CGGGGGGGACAGGGGACAGGGGG - Intergenic
901664266 1:10817480-10817502 CAGGGGGGTCAAGGCTAGGGAGG - Intergenic
901756720 1:11445910-11445932 AACTGGGGACAAGGGGTGGGTGG + Intergenic
902668350 1:17954714-17954736 CTGGGGGCACAGGGGTCGGGGGG - Intergenic
902723873 1:18322703-18322725 CAGGGGTGGGCAGGGGCGGGAGG - Intronic
902923399 1:19680443-19680465 CTGGGGGCAAAAGGGGCAGGTGG + Intergenic
904213126 1:28898727-28898749 CAAGGCGGGCAAGGGGCAGGAGG - Intronic
904301361 1:29556777-29556799 CTGTGGGGACAAGTGGAGGGAGG + Intergenic
904339982 1:29828312-29828334 CTGTGGGGACAAGTGGAGGGAGG + Intergenic
904458102 1:30659157-30659179 CAGGGAGGACAAGGAGGAGGAGG + Intergenic
904978893 1:34480003-34480025 CAGAGGGGAGAAGGGGTTGGGGG + Intergenic
905429064 1:37908492-37908514 CAGGGAGGCTAAGAGGCGGGAGG + Intronic
905462015 1:38128113-38128135 GAGGGAGGACAAGGAGGGGGAGG + Intergenic
905889668 1:41511189-41511211 GAGGGCGGAGAAGGGTCGGGAGG + Exonic
905927814 1:41764402-41764424 CTGATGGGACAAGGTGCGGGTGG + Intronic
906652855 1:47525353-47525375 GAGTGGGGAGAAGGGGCAGGAGG + Intergenic
906695771 1:47822450-47822472 CAGGGGTGATGAGGGGAGGGGGG + Intronic
906742476 1:48196287-48196309 CAGGGAGGCTAAGAGGCGGGAGG - Intergenic
907222945 1:52920994-52921016 GAGCGGGGACGAGGGGTGGGGGG - Intronic
908733268 1:67248921-67248943 CAGGAAGCACAAGGGGCTGGGGG - Intronic
909662944 1:78104174-78104196 GAGGGGGGAGAGGGGGCCGGGGG + Intronic
910038909 1:82823744-82823766 CAGGGTGGAGTTGGGGCGGGGGG - Intergenic
910576995 1:88776214-88776236 CAGGGAGGGCAAGGGGGAGGGGG - Intronic
910679959 1:89852864-89852886 CAGAGGGGAGAAGAGGCTGGAGG + Intronic
910775529 1:90870992-90871014 AAGGGGAGAAAAGGGGCAGGAGG - Intergenic
912340816 1:108912900-108912922 TGGGGGGGACACGGGGCGGGGGG + Intronic
913077215 1:115350958-115350980 CAGGCTGGACATGAGGCGGGAGG + Intergenic
914915345 1:151815995-151816017 CAGGGGTGCAAAGGGGCAGGCGG - Intronic
915264319 1:154705157-154705179 CAGATGGGAAAAGGGGCAGGTGG - Exonic
915463363 1:156082282-156082304 CGGGGGTGACGGGGGGCGGGGGG + Intergenic
915595318 1:156893653-156893675 GAGGGGCGCCGAGGGGCGGGGGG - Intergenic
915601146 1:156924049-156924071 CGGAGGGGACGAAGGGCGGGTGG - Exonic
915912709 1:159924526-159924548 CAGGAGGCACAGGGCGCGGGGGG + Intronic
916490880 1:165301250-165301272 CAGGTGGGACGAGAGGCAGGTGG - Intronic
916574993 1:166059288-166059310 CAGAGAGGAGAAGGGGCTGGAGG + Intronic
917111799 1:171556358-171556380 CAGGAAGCACAAGGGGTGGGGGG - Intronic
917817706 1:178726316-178726338 GAGGGGGGAGCTGGGGCGGGGGG - Intronic
918045585 1:180939109-180939131 CTGGGGGGAGAAGGGGGGAGTGG + Intronic
920301420 1:204991372-204991394 CAGGGCGGACAAGGAGGGAGAGG + Intronic
920694328 1:208170414-208170436 CAGGGGGAAGCAGGGGCGGGTGG + Intronic
920932288 1:210400414-210400436 CAGGGAGGAAGAGGGGAGGGAGG - Intronic
921538119 1:216377698-216377720 CAGGGGAGAGCAGGGGAGGGGGG + Intronic
923225105 1:231931937-231931959 CAGGTGGGACCAGGGGTTGGTGG - Intronic
923506522 1:234609928-234609950 CCGGGGGGGCAGGGGGCGGGGGG + Intergenic
924581838 1:245330400-245330422 CAGCAGGGACAACGGGTGGGTGG + Intronic
1062818438 10:516832-516854 GAGGGGGGACAGGGGGATGGGGG + Intronic
1062992919 10:1836808-1836830 CAGGTGGGAGAGGGGGCGGCAGG - Intergenic
1063371301 10:5524669-5524691 CAGGTGGGAGACGGGGAGGGAGG + Exonic
1063434341 10:6018304-6018326 CAGGGAGGACAGGGTGAGGGTGG + Intronic
1064133762 10:12732673-12732695 TGGGAGGGACAGGGGGCGGGGGG - Intronic
1064478717 10:15719402-15719424 CAGGGGAGAGAAGGGGCTGGTGG + Intronic
1067837045 10:49648005-49648027 CAGGGGACACTGGGGGCGGGAGG + Intronic
1069692634 10:70363946-70363968 CAGGGAGGAGAGGGGGCTGGAGG - Intronic
1070148544 10:73791836-73791858 CTGTGGGAACAAGGGGCAGGAGG - Intronic
1071486501 10:86105925-86105947 CAAGGGGGACAAGAGGATGGGGG + Intronic
1071598011 10:86942168-86942190 CAGGTGGGCCAAGGGGAAGGTGG + Intronic
1073429410 10:103476566-103476588 GAGGGGGGTCAAGGGGCAGCTGG + Intronic
1073432136 10:103493796-103493818 CAGGAGGGACCCGGCGCGGGCGG + Intergenic
1073487212 10:103827121-103827143 CAGGGTGGATGAGGGGTGGGAGG + Intronic
1073649093 10:105339967-105339989 GAGGGAGGAGAAGGGGAGGGAGG - Intergenic
1073770670 10:106731905-106731927 CAGGGAGGACAAGAGGAAGGAGG + Intronic
1073998155 10:109339567-109339589 CAGGAAGCACAAGGGGCCGGGGG - Intergenic
1074760738 10:116665562-116665584 CAGGGGTGACCAGGGGTGAGGGG + Intronic
1074776291 10:116770524-116770546 CAGGTGGCACAGGGGGCGGCAGG + Intergenic
1074885438 10:117689323-117689345 AAGGGGGAAGAAGGGGAGGGAGG + Intergenic
1074908636 10:117887143-117887165 CAGGAGGGAGAAGGGGAGAGGGG - Intergenic
1075483294 10:122800155-122800177 CAGGAGGGACTGGGGGCAGGAGG + Intergenic
1075724271 10:124603623-124603645 CAGGTTGGGCAAGGGGAGGGCGG + Intronic
1075802072 10:125160125-125160147 GAGGGGGGACACGAGGCCGGGGG + Intronic
1076626495 10:131824404-131824426 CAGTAGGGAGAAGGGGAGGGAGG - Intergenic
1076790678 10:132775196-132775218 CAGGGAGGAGAGGGGGCAGGGGG + Intronic
1076802178 10:132835869-132835891 GAAGGGGGAGCAGGGGCGGGAGG - Intronic
1076849948 10:133087883-133087905 CAGCGGGGACCCGGGGCCGGAGG - Exonic
1077063310 11:627014-627036 CAGGGCGCACTGGGGGCGGGTGG + Intronic
1077080075 11:721204-721226 CAGGTGGGCCGAGGGGCTGGAGG + Exonic
1077167560 11:1150626-1150648 CATGGGGGCCGAGGGGTGGGGGG + Intergenic
1077207817 11:1352752-1352774 CAGTGGGGATGAGGGGTGGGGGG - Intergenic
1077249471 11:1554618-1554640 CAGAAGGGACAAGGGGAAGGGGG + Exonic
1077249980 11:1556789-1556811 GAGGGCGCACAGGGGGCGGGCGG - Exonic
1077298224 11:1835856-1835878 GAGTTGGGACAAGGGGCAGGTGG - Intronic
1078574051 11:12483673-12483695 CAGGTGGGCCAAGGAGCTGGGGG + Intronic
1080844538 11:36015311-36015333 CAATGGGGGCAGGGGGCGGGGGG - Intronic
1081537271 11:44005051-44005073 CACGGGGGAGAAGGGGTGGGTGG - Intergenic
1081774035 11:45665660-45665682 TGGGGAGGAGAAGGGGCGGGCGG - Intergenic
1081854865 11:46296749-46296771 GAGGGCGGCCAAGGGGCAGGCGG - Intronic
1083659837 11:64246878-64246900 CGCGGGGGACAAAGGGCGGGCGG - Exonic
1083849159 11:65355169-65355191 CACGAGCGACAAAGGGCGGGAGG - Intronic
1083944280 11:65915491-65915513 GAGCGGGGACAAGAGGAGGGTGG + Intergenic
1083964481 11:66035025-66035047 CAGGTGGCACAAGGGGAAGGGGG + Intergenic
1084189874 11:67494072-67494094 TGGAGGGGAGAAGGGGCGGGAGG + Intronic
1084642494 11:70434205-70434227 CTGAGGGAACACGGGGCGGGCGG - Intronic
1085025316 11:73233038-73233060 CAGTGGGGACAAGGTTGGGGGGG + Intronic
1085597030 11:77820182-77820204 CAAGGGGGAGACGGGGTGGGGGG + Intronic
1086356721 11:86008847-86008869 CAGGGAGGCTAAGAGGCGGGAGG + Intronic
1087666319 11:101053504-101053526 AAGGAGGGAGAAGGGGAGGGAGG - Intronic
1088870449 11:113886193-113886215 CGGGGGGGGCAGGGGGTGGGGGG - Intergenic
1089209659 11:116791623-116791645 CAGCGGGGACAAAGGCAGGGTGG - Exonic
1089533972 11:119149561-119149583 CAGGGCGGACCAGGGGAAGGCGG - Intronic
1089614364 11:119686923-119686945 CAGGGGGCCCAAGTGGCAGGTGG + Intronic
1089684262 11:120137061-120137083 TAGGGGGGACAGGGGGCATGAGG + Intronic
1091713447 12:2759608-2759630 CAGAGGGGAGAAGGGGTGTGGGG - Intergenic
1092900434 12:13054725-13054747 CAGTGAGGCCAAGGGGTGGGTGG + Intronic
1092923756 12:13255995-13256017 CAGGGAGGAGAAGGGGAGGGAGG + Intergenic
1093458202 12:19384946-19384968 CAGGGAGGCTAAGAGGCGGGAGG + Intergenic
1097003793 12:55900628-55900650 CTGGGGGGACACTCGGCGGGAGG + Intergenic
1097747536 12:63316904-63316926 GTGGGGGGGCAGGGGGCGGGGGG + Intergenic
1098569939 12:71976952-71976974 CAGTGGTTACAAGGGGCAGGAGG + Intronic
1101889895 12:108703844-108703866 CAGGAGGAACAAGGGGCTGGAGG - Intronic
1102106914 12:110333106-110333128 GCGGGGGGGCAGGGGGCGGGAGG + Intronic
1102258547 12:111429844-111429866 CGGGGGGCACCAGGGGCAGGGGG + Intronic
1102371087 12:112382563-112382585 CCAGGGGGAGAAGGGGCCGGCGG - Intergenic
1102466993 12:113135756-113135778 CTGGGCGGGCAGGGGGCGGGAGG + Intronic
1102471716 12:113163202-113163224 CAGGGGAGCCAAGAGGCGGAGGG - Exonic
1102703422 12:114860313-114860335 CAGTGGGGCCCAGGGGCTGGAGG - Intergenic
1102854040 12:116277762-116277784 CGGGGGGAGCGAGGGGCGGGCGG + Intergenic
1103085638 12:118060722-118060744 CGGGTGGGACTCGGGGCGGGGGG - Intronic
1103483755 12:121268737-121268759 CAGGGAGGAAAAGGGGAAGGAGG + Intronic
1104054390 12:125218194-125218216 CCTGGGGGACAAGGGATGGGAGG + Intronic
1104536341 12:129621381-129621403 CAGTGGGGGCAGGGGGAGGGTGG - Intronic
1104813293 12:131631386-131631408 GATGGGGGACAAGGGGTGGATGG + Intergenic
1104957995 12:132475262-132475284 CCGGGGAGAGAGGGGGCGGGGGG - Intergenic
1104972742 12:132539366-132539388 CTGGGTGGACATGGGGCTGGAGG - Intronic
1104972752 12:132539395-132539417 CTGGGTGGACATGGGGCTGGAGG - Intronic
1105058881 12:133130008-133130030 GAGTGGGGACCAGGGGCGCGCGG - Intronic
1105209384 13:18248941-18248963 CAGCGGGGACAAAGGCCTGGGGG + Intergenic
1106308229 13:28532295-28532317 CAGGGTGGACAGCGGGCGGGTGG - Intergenic
1108622860 13:52201138-52201160 GAGAGGGGCCAAGGGACGGGGGG - Intergenic
1110119851 13:71866849-71866871 AAGGGGGGAGAAGGAGCGAGGGG + Intronic
1110515848 13:76411461-76411483 GAGGGGGGAGGAGGGGAGGGGGG + Intergenic
1110515872 13:76411508-76411530 GAGGGGGGAGGAGGGGAGGGGGG + Intergenic
1112070722 13:95846415-95846437 CAGAGGGGAGGAGGGGAGGGGGG + Intronic
1112573361 13:100613813-100613835 TAGGGGGGAGAGGGGGAGGGAGG - Intronic
1112890803 13:104228728-104228750 CAGGGAGGCTAAGAGGCGGGAGG - Intergenic
1113653806 13:112056103-112056125 CCGGGTGGACACGGGACGGGAGG + Intergenic
1114450064 14:22819602-22819624 GAGGAGGGACAATGGGCGAGAGG - Intronic
1115498282 14:34027429-34027451 GAGGGGGAAGAAGGGGAGGGGGG + Intronic
1116525135 14:45894824-45894846 AAGGGGGGTTAAGGGGCTGGGGG + Intergenic
1118442912 14:65828157-65828179 CAAGGTGGTCAAGGGGCGGATGG + Intergenic
1118892195 14:69919911-69919933 CAGGGGAGAAAGGGGGGGGGGGG - Intronic
1119410448 14:74426720-74426742 GAAGGGGGACAGGGGGAGGGGGG - Intergenic
1119701918 14:76761523-76761545 CAGCGGGGCCCAGGGGCGGCGGG + Intergenic
1120881222 14:89416808-89416830 CGGGGGGCACCCGGGGCGGGAGG - Intronic
1121010245 14:90516091-90516113 CAGTGGGGACGAGGTGGGGGAGG + Intergenic
1121325407 14:93016856-93016878 CAGGGTGGACAAGAGGATGGGGG - Intronic
1121473638 14:94174855-94174877 CAGGAGGGGCAAGGGCCGCGGGG - Intronic
1122079218 14:99255436-99255458 CAGGGGGGCCAGGGGGTGGAAGG + Intronic
1122220992 14:100239106-100239128 GCGGGGGGAGAGGGGGCGGGCGG - Exonic
1122518687 14:102327108-102327130 CAGCAGGAACAAGGGGCAGGGGG + Intronic
1122551100 14:102550474-102550496 CACGGGGGACCAGGTGCAGGGGG - Intergenic
1122721968 14:103727361-103727383 GAGGGGGCAGAGGGGGCGGGGGG - Intronic
1124554108 15:30709526-30709548 AGGGGGGCACAAGGGGCTGGGGG - Intronic
1124677138 15:31696145-31696167 AGGGGGGCACAAGGGGCTGGGGG + Intronic
1125621747 15:41069229-41069251 CAGGGGGGTGAGGGGGCGAGGGG - Intronic
1126089365 15:45037804-45037826 GGTGGGGGACAAGGGGAGGGAGG + Intronic
1126176516 15:45740932-45740954 CCTGGGGGACAAGGGGATGGTGG - Intergenic
1126895609 15:53254113-53254135 CAAGGGGGAAAAGGGGCAAGTGG + Intergenic
1126915070 15:53457289-53457311 CTGGGGGAACAGGGGGCAGGTGG - Intergenic
1128157784 15:65402523-65402545 CAGGGGGGCCACAGGGAGGGTGG + Intronic
1128844123 15:70874319-70874341 CAGGAGGTACAAAGGGCAGGTGG + Intronic
1129020505 15:72513708-72513730 AAGGAGGGACAGGGGGAGGGAGG - Intronic
1129460073 15:75696175-75696197 CAGGAGGGGGAAGGGGTGGGAGG - Intronic
1129644710 15:77419749-77419771 CAGGGGCGGCAGGGGGCGCGCGG + Intronic
1131070139 15:89460942-89460964 CTGGGGGGCCAAGGGGGTGGGGG - Intergenic
1131377449 15:91937317-91937339 CATGGGGAACAAGTGGCGGGAGG + Intronic
1131721167 15:95170428-95170450 GAGGGGGGAGAAGCGGAGGGAGG - Intergenic
1132283227 15:100638829-100638851 AGTGGGGGACAAGGGGAGGGAGG - Intronic
1132592961 16:734357-734379 CAGGGGGCACACGGGGCTGGCGG + Intronic
1132676291 16:1122648-1122670 CAGGGGGGTCCAGCGGCGTGTGG - Intergenic
1132724338 16:1332415-1332437 CTTTGGGGACAAGGGGTGGGGGG - Intergenic
1132956241 16:2595506-2595528 CAGCGGGGAAAAGGTGGGGGAGG - Intronic
1133014738 16:2934120-2934142 CAGGGGGGCCAAGGAGTAGGAGG - Intronic
1133241286 16:4416051-4416073 CAGGGGCGACCCGGGGCGGCAGG + Intronic
1134041702 16:11073664-11073686 CAGGGGCGACAAGGGCAGGCAGG - Intronic
1134066598 16:11232467-11232489 CAGGGGGGAGGAGGAGGGGGAGG + Intergenic
1134124916 16:11610040-11610062 CAGTGGGGACTAGGGTGGGGAGG - Intronic
1134482196 16:14629839-14629861 CAGGGGGGACAAGCCCCGGGGGG + Intronic
1135179373 16:20259547-20259569 CAGGGGGTAAAAAGGGAGGGAGG + Intergenic
1136577052 16:31131172-31131194 CTGTGGGGAGAAGGGGCGGGAGG - Exonic
1136705879 16:32187934-32187956 CGGGCGGCACAAGGGGTGGGGGG - Intergenic
1136762033 16:32741471-32741493 CGGGAGGCACAAGGGGTGGGGGG + Intergenic
1136806067 16:33128917-33128939 CGGGAGGCACAAGGGGTGGGGGG - Intergenic
1137056117 16:35747378-35747400 CTGGGGAGACCAGGGGCTGGAGG + Intergenic
1137056592 16:35749132-35749154 CGGGGGTGACCAGGGGCTGGAGG + Intergenic
1138520332 16:57567444-57567466 CAGGAGGGAAGAGGGGCTGGAGG - Intronic
1139332661 16:66205557-66205579 GAGGGGGAACAAAGGGAGGGAGG + Intergenic
1139570840 16:67811063-67811085 CAGGGAGGCTAAGAGGCGGGAGG - Intronic
1139580773 16:67872599-67872621 CAGGTGGGACAAGGGGATGCTGG + Intergenic
1139908463 16:70381935-70381957 CAGGGAGGAGAGGGGACGGGAGG + Intronic
1140046132 16:71441630-71441652 CAGGGGGCACCAAGGGCCGGGGG + Intergenic
1140219518 16:73033508-73033530 CTGGGGGGAAAGGGGGCAGGCGG + Intronic
1142036980 16:87868574-87868596 CAGCGGGGCCAACGGGAGGGTGG + Intronic
1142232215 16:88905336-88905358 CAGAGGGAACGAGGGGCGGTGGG - Intronic
1142245014 16:88966406-88966428 CAGGTGGGAGAGGGGCCGGGAGG - Intronic
1142246547 16:88972802-88972824 AAGGGGGGACAGGAGGCGGGAGG + Intronic
1142359259 16:89619049-89619071 CAGGGGGGGCAGGGGGCTGCAGG - Intronic
1142359396 16:89619352-89619374 CAGGGGGGGCAGGGGGCTGCAGG - Intronic
1142359411 16:89619383-89619405 CAGGGGGGGCAGGGGGCTGCAGG - Intronic
1203064192 16_KI270728v1_random:1001787-1001809 CGGGCGGCACAAGGGGTGGGGGG + Intergenic
1142669437 17:1480937-1480959 CAGGGGAGAAGAGGGGCAGGTGG - Intronic
1142693576 17:1621250-1621272 CCGGGGAGACAAAGGGAGGGGGG + Intronic
1142709622 17:1716013-1716035 CCGGGAGGAGAAGGGGCGGCGGG - Intergenic
1142743050 17:1941802-1941824 CAGGGGGTACCAGAGGCGGCGGG - Intronic
1142827416 17:2522510-2522532 CATGGAGGACAAGGGAGGGGAGG - Intergenic
1143083330 17:4397354-4397376 CATGTGGGGCAGGGGGCGGGAGG + Intergenic
1143096784 17:4482638-4482660 CAGCGGGGCCAAGGGGAGGCTGG - Intronic
1143373781 17:6455692-6455714 CAGGGGGAAGAAGGGAGGGGAGG + Intronic
1143498247 17:7324481-7324503 CTGGGAGGACAAGGAGCAGGAGG + Intronic
1143513491 17:7408142-7408164 CAGGAGGGAGGAGGGGCGGGGGG - Intronic
1143659197 17:8314392-8314414 CAGGGGAGATAAGGGGCTGCAGG + Intronic
1144020995 17:11240467-11240489 GAGGGGGGACAGGGGAGGGGAGG - Intergenic
1144576286 17:16431881-16431903 CAGGGTGGACAAGGAACGTGGGG - Intronic
1144696304 17:17306100-17306122 CATGAGGGACAAGGGGGAGGGGG - Intronic
1144703407 17:17352680-17352702 CTGGGTGGTCACGGGGCGGGGGG + Intergenic
1144756417 17:17682600-17682622 CGGCGGGGACAAGGGGTGGCAGG + Intronic
1145878289 17:28335933-28335955 CCTGGGGGAAAAGGCGCGGGCGG + Intronic
1147323552 17:39659726-39659748 AAGGGGGGCCAAGGGGCACGGGG - Intronic
1147758359 17:42782434-42782456 CAGGCCGGCCATGGGGCGGGAGG - Intronic
1147840625 17:43369012-43369034 CTGGGGCGGCACGGGGCGGGGGG + Intergenic
1147910419 17:43852923-43852945 AAGGTGGGAGAAGGGGAGGGAGG - Exonic
1148231376 17:45937282-45937304 CAGGGGAGAGAAGGGAGGGGAGG + Intronic
1148783754 17:50135276-50135298 GAGGGAGGACAATGGGAGGGGGG + Exonic
1148910951 17:50942467-50942489 CTGTGGGCACAAGGGGCTGGCGG - Intergenic
1149540296 17:57463441-57463463 CAGTGGGGCCATGGGGAGGGAGG - Intronic
1149576386 17:57716317-57716339 AAAAGGGGACAAGGGGCTGGGGG - Intergenic
1149754316 17:59174885-59174907 GAGGCTGGACAAGGGGAGGGAGG - Intronic
1150245160 17:63669235-63669257 CACAGGGGACAAGGGGAGAGAGG + Intronic
1150389018 17:64780360-64780382 CAGGGAGCCCAAGGGCCGGGTGG + Intergenic
1150790428 17:68197557-68197579 CAGGGAGCCCAAGGGCCGGGGGG - Intergenic
1151322575 17:73360607-73360629 CTGGGGGGATGAGGGGTGGGAGG + Intronic
1151327651 17:73388905-73388927 AAGGGGGGAAAAAGGGAGGGAGG - Intronic
1152197425 17:78925622-78925644 CAGCGGGGACCGGGGTCGGGGGG - Intergenic
1152239130 17:79152443-79152465 TAGGGGGGACTAGGGTGGGGGGG + Intronic
1152426333 17:80220523-80220545 GAGCGGGGACCAGGGGCAGGGGG + Intronic
1152539126 17:80966121-80966143 CAGGGTGGAGCGGGGGCGGGGGG - Exonic
1152746065 17:82039929-82039951 CAGGGCGGCCAAGGGGGGGTTGG - Intergenic
1153269564 18:3306518-3306540 CAGGAGGGACAAGGATAGGGAGG - Intergenic
1153970907 18:10226170-10226192 TTGGGGGGGCAGGGGGCGGGGGG - Intergenic
1154194442 18:12255025-12255047 CAGGGGGGACAAGGGGCGGGTGG + Intronic
1154501874 18:15001351-15001373 GAGGGGGGAGATGGGGTGGGTGG - Intergenic
1154991117 18:21599715-21599737 CAGCGGGGACCAGGGGAGGGAGG - Intronic
1155025712 18:21938731-21938753 CAGAGGTGACCAGGGGCTGGGGG + Intergenic
1156270170 18:35523465-35523487 TTGGGAGGCCAAGGGGCGGGAGG - Intergenic
1156291925 18:35755047-35755069 GTGGAGGGAGAAGGGGCGGGTGG - Intergenic
1156479466 18:37427026-37427048 CAGCAGGGACACGGGGGGGGGGG + Intronic
1157682259 18:49616321-49616343 CAGGGGTGCCAAGGGGAGGCTGG - Intergenic
1158618883 18:59013131-59013153 GAGGCGGGAGAAGGGGCAGGAGG - Intergenic
1159304458 18:66622093-66622115 CAGGGAGGCTAAGAGGCGGGAGG + Intergenic
1159931399 18:74316021-74316043 CAGGGGGAGGAAAGGGCGGGTGG - Exonic
1160448643 18:78947017-78947039 GAGGAGGGACGAGGGGAGGGAGG + Intergenic
1160702104 19:512630-512652 CGGGGTGGAGAAGTGGCGGGTGG + Intronic
1160883926 19:1336041-1336063 CCGGTGGGAGAAGGGGCTGGTGG + Intergenic
1161010827 19:1958711-1958733 ATGGGGGGACGAGGGGAGGGGGG - Intronic
1161114384 19:2488627-2488649 CAGGGAGGAAAAGGGAGGGGCGG + Intergenic
1161231336 19:3176531-3176553 CTGGGGGGACAGAGGGCAGGTGG + Intronic
1161589326 19:5121975-5121997 CAGCGTGGACAGGGGGAGGGAGG - Intronic
1161796099 19:6387603-6387625 CCGGGGGGACACGGGGGGGCTGG - Intronic
1161983564 19:7642676-7642698 CAGGGGGGACAGGGAGAGGTGGG - Intronic
1162018518 19:7858161-7858183 CAGCGAGGACAGGGGGCAGGGGG - Intronic
1162237695 19:9321710-9321732 CAGGGGGGAGGAGGGCGGGGGGG - Intergenic
1162327667 19:10008429-10008451 TACAGGGGACAAGGGGTGGGGGG + Intronic
1162549660 19:11351485-11351507 CAGGGGAGACAGGTGGCTGGTGG + Intronic
1162779081 19:12997193-12997215 CAGTGGTGTCAAGGGGCGAGGGG + Intronic
1162915829 19:13873894-13873916 CTGGGGGCACCCGGGGCGGGGGG + Intronic
1163019124 19:14473302-14473324 CTGGGACGACAAAGGGCGGGAGG + Intronic
1163554353 19:17983801-17983823 CAGAGGGCAGGAGGGGCGGGGGG - Intronic
1163695069 19:18759934-18759956 CGGCGGGGACAGGGGGCTGGCGG - Intronic
1163757100 19:19112594-19112616 CAGGAGAGACAAGGGGTAGGTGG + Exonic
1165059579 19:33198569-33198591 TAGGGTGGAGAAGGGGCTGGGGG - Intronic
1165062185 19:33210385-33210407 CAGTGGGCACCAGGGGCAGGTGG - Intronic
1165655846 19:37531555-37531577 CAGTGGGAACAAAGGCCGGGGGG - Intronic
1165914339 19:39248398-39248420 CAGGGGGCACAGGGGCTGGGCGG + Intergenic
1166205249 19:41264989-41265011 CAGGGGGGACACTGGGGGAGGGG + Intronic
1166250420 19:41565535-41565557 CAAGGGGGGCGGGGGGCGGGGGG - Intronic
1166338268 19:42121984-42122006 CAAGAGTGAGAAGGGGCGGGAGG + Intronic
1166498532 19:43324064-43324086 CAAGCGGGATTAGGGGCGGGTGG + Intergenic
1166688675 19:44810339-44810361 GAGGGGGGCCAAGAGGCGGCTGG + Intronic
1167055587 19:47109949-47109971 CCGGGGGGACTGGGGGCTGGAGG + Intronic
1167070865 19:47221429-47221451 CAGGGGTGACACTGGGAGGGGGG - Exonic
1167509294 19:49887849-49887871 CAGGGGGGACAGGGCGGGGGCGG - Intronic
1167648671 19:50718669-50718691 GTGGGGGGACAGGGGGCGGCTGG + Intronic
1167798178 19:51724267-51724289 CAGGGGAGACAAGGGACGAGAGG - Intergenic
1168253551 19:55154935-55154957 GAGGGAGGAGAAGGGGCTGGGGG + Intronic
1168253578 19:55155009-55155031 GAGGGAGGAGAAGGGGCTGGGGG + Intronic
1168287575 19:55342208-55342230 CAGGGGGGGCACAGGGCTGGGGG - Exonic
1168389358 19:55993476-55993498 GAGGGGGGAGAGGGGGAGGGAGG - Intergenic
1168493979 19:56835173-56835195 CAGGGTGCAGAAGGGGAGGGTGG - Intronic
925422869 2:3726113-3726135 CAGGGGAAACCAGGGGTGGGAGG + Intronic
925706149 2:6686060-6686082 CAGAGGGGACAACGAGCCGGAGG + Intergenic
925846924 2:8043048-8043070 CAGAGGGGCCATGGGGCGGGGGG + Intergenic
926001405 2:9336290-9336312 CAGGGGAGAGAAAGGGAGGGAGG - Intronic
928083042 2:28326859-28326881 AAGGGGAGACTAAGGGCGGGAGG - Intronic
929794339 2:45047435-45047457 CAGAGGGCACACGGGGTGGGGGG + Intergenic
930067014 2:47335353-47335375 CAGGGAGGCTAAGAGGCGGGAGG + Intergenic
930899140 2:56482353-56482375 CAGGGTGGTCAAGGGGTAGGTGG - Intergenic
932090221 2:68799742-68799764 CTGGGGGAAGAAGGGCCGGGAGG + Intronic
932406918 2:71519480-71519502 CAGGGGGCAGCAGGGGCAGGGGG - Intronic
934101942 2:88661414-88661436 CAGGTGGGACAAAAGGCGAGGGG + Intergenic
934490077 2:94756458-94756480 CTGGTGGGACAACGGGCAGGTGG - Intergenic
934845305 2:97658409-97658431 AAGAGGTGACAAGGGGCGAGAGG - Exonic
935075944 2:99744031-99744053 CAGAGGGCAGAAGGGGAGGGAGG - Intronic
936081931 2:109438191-109438213 CTGATGGGACAAGGGGTGGGAGG + Intronic
936457815 2:112688784-112688806 CAGTGGGGAGAGGGGCCGGGGGG - Intergenic
937097492 2:119245246-119245268 CAGGAGGGACAAAGGGTGGAGGG + Intronic
937909075 2:127066662-127066684 CATGGGGAACCAGGGGCTGGGGG - Intronic
938436613 2:131286992-131287014 CAGGGAGGATAAGGGGGTGGAGG - Intronic
938501056 2:131831520-131831542 GAGGGGGGAGATGGGGTGGGCGG - Intergenic
939003767 2:136764368-136764390 CAAAAGGGAGAAGGGGCGGGGGG - Intergenic
939267505 2:139892435-139892457 CAGGGAGGCTAAGAGGCGGGAGG + Intergenic
941826192 2:169899653-169899675 CAGGCCGGGCAAGGGGCGGGGGG - Intronic
941900359 2:170672219-170672241 GATGGGGGAGATGGGGCGGGGGG + Intergenic
942228250 2:173835722-173835744 CAAGGGGGTCAAGGGGTTGGAGG - Intergenic
942779897 2:179629725-179629747 CAGGAAGCACAAGGGGCTGGGGG + Intronic
944818034 2:203399513-203399535 GCGGGGGGAGGAGGGGCGGGCGG + Intronic
945241525 2:207681363-207681385 CGCGGGGGACAAAGGGCGGGCGG + Intergenic
946200061 2:218065997-218066019 CTTGGGGGACAAGGGGGGTGGGG + Intronic
946433041 2:219635650-219635672 CTGGGGGAACAAGGGGCTGCTGG - Intronic
947483548 2:230525620-230525642 CAGGAAGCACAAGGGGTGGGGGG + Intronic
948283853 2:236769178-236769200 CAGGAGGGACATGGGGCAGGGGG + Intergenic
948805797 2:240453116-240453138 CGGTGGGGACGAGGAGCGGGTGG - Intronic
948925829 2:241096675-241096697 CAGGAGGGAGAAGGGGCAGAAGG + Intronic
1169506102 20:6213245-6213267 CAGTGGGGTAAAGGGGGGGGGGG + Intergenic
1170150676 20:13222497-13222519 AAGGGGGCACAAGGGGGGAGGGG - Intronic
1170402982 20:16007771-16007793 CAGAGGGGAAAAGGGTAGGGTGG - Intronic
1171137822 20:22712722-22712744 AAGGGAGGAGAGGGGGCGGGGGG + Intergenic
1171204276 20:23266937-23266959 CAGGTGGGAGGAGGGGCGGTGGG + Intergenic
1171896897 20:30816078-30816100 CAAGGGGGAGCAGAGGCGGGGGG + Intergenic
1172045882 20:32079888-32079910 CAGGGAGGACAAGGTGGGGAGGG - Intronic
1172225569 20:33303046-33303068 CAGGGTGAACAAAGGGCGGAGGG - Exonic
1174164576 20:48575704-48575726 CAGAGGGGAGGAGGGGAGGGAGG + Intergenic
1174532004 20:51221731-51221753 CAGAGGGAGCAAGGGGTGGGAGG + Intergenic
1175077979 20:56392091-56392113 CGGCGGGGACAAGGGGCGGCTGG - Exonic
1175206894 20:57317971-57317993 CAGGGGGCACAAGGGGCAGAAGG - Intergenic
1175210442 20:57350864-57350886 GCGGGGGGACGGGGGGCGGGGGG + Intergenic
1175215250 20:57389184-57389206 CAAGGGGGCCCGGGGGCGGGGGG + Intergenic
1175776816 20:61658863-61658885 CAGGGAGGACCAGGGTAGGGGGG + Intronic
1175841069 20:62027878-62027900 GAGAGGGGTCAAGGGGCAGGCGG - Intronic
1176081059 20:63273162-63273184 AAGGGGGCACGAGGGGCGGGGGG - Intronic
1176143291 20:63554312-63554334 CAGGGGAGCCAAGGGGAGTGTGG + Exonic
1176426570 21:6552424-6552446 GAGGGTGGAGAAGGGGTGGGAGG - Intergenic
1177775505 21:25562036-25562058 GAGGGGGGAGAAGGGGGGGGGGG + Intergenic
1177855927 21:26400055-26400077 CAGGAGGAAGCAGGGGCGGGGGG - Intergenic
1178091911 21:29172844-29172866 CACTGGGAACAAGGGGCGGGGGG - Intronic
1178360442 21:31944639-31944661 CAAGGAGGAGAAGGGGAGGGAGG + Intronic
1178514069 21:33230765-33230787 CAGGAGGGGGAAGGGGCGAGGGG + Intronic
1178544173 21:33479634-33479656 CAGGGGCAAGAAGGGGCGGCGGG + Intronic
1179209349 21:39312944-39312966 CGGGGGGGGCGGGGGGCGGGGGG + Intronic
1179226070 21:39454565-39454587 CAGGGGGGACAAAGGGAGAGAGG + Intronic
1179613865 21:42569377-42569399 CAGGGAGGCCATGTGGCGGGAGG - Intronic
1179702061 21:43160746-43160768 GAGGGTGGAGAAGGGGTGGGAGG - Intronic
1180090343 21:45531005-45531027 CTGGGGGGCCACGGGGCAGGGGG + Intronic
1180647021 22:17347775-17347797 CAGGGAGGACATGGGAAGGGAGG - Intergenic
1180875044 22:19171283-19171305 CAGGGGAAAGGAGGGGCGGGAGG + Intergenic
1181604298 22:23971030-23971052 CAGTGGGGAAAAGGGGAGAGTGG + Intronic
1181618009 22:24068197-24068219 CAGGAGGGAGAAGGGGGTGGAGG + Intronic
1181828525 22:25539715-25539737 CAGGGGGTACAAGGCAGGGGTGG - Intergenic
1182261062 22:29073275-29073297 GAGGGGCGACAAGGGCCGGCCGG + Intronic
1182440600 22:30361829-30361851 GAGGGGAGAGAAGGGGCAGGTGG - Intronic
1182576444 22:31276478-31276500 CGCAGGGGACAAAGGGCGGGCGG + Intronic
1182745943 22:32605664-32605686 CAGGAGGGAGCAGGGGCGGGTGG - Intronic
1183303280 22:37069045-37069067 CAGCGGGGACTTGCGGCGGGAGG - Intronic
1183362092 22:37388016-37388038 AAGGCGGGACTAGGGGCAGGTGG - Intronic
1183617481 22:38954422-38954444 CGGGGGGGACAAAGGGTGGGGGG - Intronic
1184144497 22:42601267-42601289 CAGGGAGGCTAAGAGGCGGGAGG + Intronic
1184226191 22:43130051-43130073 CAAGGGGCACCAGGGGCAGGAGG + Intergenic
1184769462 22:46589073-46589095 CAGGGACGGCAGGGGGCGGGGGG + Intronic
1184778741 22:46635746-46635768 CAGGAGTGGCCAGGGGCGGGGGG - Intronic
1185121723 22:48975346-48975368 CTGGGGGGACACGTGGCGAGGGG - Intergenic
1185322055 22:50205988-50206010 CAGTGGGGACAAAGGGCCTGGGG - Intronic
1185337195 22:50275984-50276006 CAGGGTGGAAAAGGGGCTGTGGG + Intronic
1185345193 22:50307780-50307802 GAGGGGGGAGAGGGGGAGGGGGG + Intergenic
949382710 3:3464007-3464029 CTGGGGGGCCAAGGGGAGTGTGG + Intergenic
950244669 3:11405274-11405296 CAGTGGGGGCAAGGGGGTGGGGG - Intronic
952213636 3:31254117-31254139 CTGGAGGGAAAAGGGGTGGGGGG - Intergenic
952277793 3:31894296-31894318 CAAGGAGGACAAGGGGAGGCAGG + Intronic
952392601 3:32893184-32893206 TTGGGGGGAGAGGGGGCGGGGGG - Exonic
953277773 3:41520223-41520245 CAGGGGTTACCAGGGGCTGGGGG - Intronic
953564146 3:44016665-44016687 CAGGGGTGACAGGTGGGGGGAGG + Intergenic
954329509 3:49882077-49882099 CAGGGGGGCCATGGAGCAGGAGG - Intergenic
954707457 3:52488720-52488742 CGGGGGGGGCGAGGGGCAGGGGG - Intronic
954968131 3:54628801-54628823 CAGGGGGTACAACAGGCAGGAGG + Intronic
955265259 3:57436815-57436837 CTGGGGGGCCAGGGGGCGGGCGG + Intronic
958533632 3:95366940-95366962 CACGGGGGACAGGGGGCGGAGGG - Intergenic
961352935 3:126315553-126315575 CAGGGGGGACAGGAGGAGAGCGG + Intergenic
961539285 3:127589439-127589461 CAGGGGTGACAAGGTGGGGAAGG + Intronic
961567546 3:127774351-127774373 CAGGGGAGGCAAGAGGCAGGAGG - Intronic
961664519 3:128487628-128487650 CTGGGGGGACTTAGGGCGGGGGG - Intronic
961674435 3:128555935-128555957 CAGGCGGCTCCAGGGGCGGGGGG - Intergenic
962367649 3:134796627-134796649 GAGGCGGGGGAAGGGGCGGGAGG - Intronic
962786055 3:138768968-138768990 CATGGGAGAGAAGGGGCTGGGGG + Intronic
963044816 3:141094774-141094796 CAGGGGGGCAAAGGGGCGGGGGG - Intronic
964282179 3:155079500-155079522 CCGGGGAGACGGGGGGCGGGCGG - Intronic
964476575 3:157102977-157102999 GGTGGGGGACAAGGGGAGGGAGG + Intergenic
964870997 3:161313735-161313757 CAGGTGGGACAAGGGTCAAGAGG - Intergenic
965861476 3:173155751-173155773 CAAGTGGGATCAGGGGCGGGTGG + Intergenic
966923511 3:184629779-184629801 CAGGCGGGAGAAGGTGGGGGAGG - Intronic
968234585 3:197024148-197024170 CGGGGGAGGCACGGGGCGGGCGG + Intronic
968811423 4:2801200-2801222 CAGTGAGGACAAGGGTCTGGCGG - Intronic
968991648 4:3917357-3917379 GAGGGGGGAGAAAGGGAGGGAGG + Intergenic
969625624 4:8303928-8303950 CAGGTGGGAGGAGGGGCGGGAGG - Intronic
969715346 4:8865655-8865677 GAGGGGTCAGAAGGGGCGGGGGG + Intronic
973317896 4:48780316-48780338 CAGGAAGGCCAGGGGGCGGGCGG - Intronic
974875792 4:67701173-67701195 TGGGGGGGTCAAGGGGCGGGCGG + Exonic
977536560 4:98261375-98261397 CGGCGGGGACGAGCGGCGGGGGG - Intronic
977923235 4:102669353-102669375 TAGGAGTGACAAGGGGCTGGAGG - Intronic
979289781 4:118966725-118966747 CAGGAGGAACTAGGGGAGGGGGG - Intronic
980022127 4:127722765-127722787 GAGGGGGGAGAAGGGAGGGGAGG - Exonic
980100637 4:128538544-128538566 CAGGGCGTGCAAGGGGCGTGTGG + Intergenic
983113345 4:163781100-163781122 TTGGGAGGCCAAGGGGCGGGGGG + Intronic
984534775 4:180960664-180960686 CAGGGGAGACGGGGGGTGGGGGG - Intergenic
984700107 4:182813784-182813806 CAGGGTGGGCCAGGGCCGGGTGG + Intergenic
984837311 4:184033893-184033915 CAGGCGGGACTTGGGGTGGGGGG - Intergenic
984955015 4:185036674-185036696 CAAGGGGGAGAAGGAGAGGGAGG - Intergenic
985520952 5:373739-373761 CCGGGTGCACACGGGGCGGGCGG - Intronic
985662146 5:1162616-1162638 CAGGGGTGACTAGGGGAGGGTGG - Intergenic
985683688 5:1270836-1270858 CGTGGAGGACGAGGGGCGGGGGG - Intronic
985749702 5:1667275-1667297 GAGGGGGGAGGAGGGGAGGGCGG - Intergenic
988058461 5:26133541-26133563 CATGGGGGACAAGGGGAGGGAGG - Intergenic
988135498 5:27165570-27165592 GTGGGGGGACAAGGGAAGGGAGG - Intergenic
988280092 5:29134262-29134284 CAGGGAGGGCAAGGGGGGGATGG + Intergenic
989465495 5:41750340-41750362 CAGGTGGGAGGAGGGGCTGGAGG - Intronic
991095976 5:62739993-62740015 GGGGAGGGACAAGGGGAGGGAGG - Intergenic
991192607 5:63893160-63893182 GATGGGGGCCAAGGGGAGGGAGG - Intergenic
992498847 5:77321989-77322011 CAGGAGGCACAGGGAGCGGGAGG + Intronic
993526840 5:88975580-88975602 CAGGGAGGCCAAGAGGCGGGAGG + Intergenic
993814675 5:92527768-92527790 AAGGGGGAAAAAGGGGTGGGTGG + Intergenic
994107304 5:95961692-95961714 CGGGGGGGACAGGGGGCCTGCGG - Exonic
996398430 5:123035825-123035847 CTGCGGGGAAAGGGGGCGGGGGG - Intronic
997180101 5:131819443-131819465 GAGGAGGGACAGGGGGAGGGAGG + Intronic
997307850 5:132852645-132852667 CAGGGGGGAGAAGGAATGGGTGG - Intergenic
998092803 5:139380909-139380931 CAGGGGTGGGGAGGGGCGGGTGG + Intronic
998535094 5:142922818-142922840 AAGGGGTGAGAAGGGGAGGGAGG - Intronic
998680007 5:144456482-144456504 CAGGGGGGTCAGGGGTAGGGAGG + Intronic
1000329519 5:160196008-160196030 CAGAGGGGACATGGGCCAGGAGG + Intronic
1001199141 5:169699933-169699955 CAGAGGGGAGAGGTGGCGGGAGG + Intronic
1001396786 5:171423523-171423545 CAGGAGGGACAAGAGGCCAGGGG - Intronic
1001396795 5:171423551-171423573 CAGGAGGGACAAGGGGCTAAGGG - Intronic
1001410015 5:171504815-171504837 GAGGGGGGACAAAGGGCTGCAGG + Intergenic
1001665981 5:173434089-173434111 CATGGGGGTCCAGGGGCAGGAGG - Intergenic
1001831757 5:174794888-174794910 CAGGGGGGACGGGGGGGGGTGGG - Intergenic
1002061943 5:176630354-176630376 CGGGGTGGACCAGGGGCCGGAGG + Exonic
1002298143 5:178242480-178242502 CAGGGGGGAAAGTGGGCGTGTGG - Intronic
1002309855 5:178307725-178307747 CAGGGGCGAGAAGGGGCGCCAGG - Intronic
1002346940 5:178554682-178554704 CAGGGGAGACAAAGTGGGGGAGG - Intronic
1002569378 5:180131356-180131378 GAGTGGGGACATGGGGAGGGTGG - Intronic
1003446899 6:6193085-6193107 CAGGGAGGACATGGGAAGGGAGG + Intronic
1004298172 6:14433239-14433261 CTGCGGGGGCAATGGGCGGGGGG + Intergenic
1004305885 6:14501673-14501695 TGGGGGGGAGAAGGGGGGGGGGG + Intergenic
1004607269 6:17206413-17206435 GAGGGGGGAGAAGGGAGGGGAGG + Intergenic
1006135988 6:31896994-31897016 GAGGGGAGACAAGGGACAGGAGG + Intronic
1006286167 6:33096199-33096221 CAGTGGGGACATGGGTCCGGAGG - Intergenic
1006400168 6:33813093-33813115 CTGGGGGGGCGGGGGGCGGGGGG + Intergenic
1006941762 6:37756327-37756349 CAGGGAGGACAAGCGGGAGGAGG + Intergenic
1007375168 6:41451519-41451541 GAGCGGGGACAAGAGGCAGGAGG + Intergenic
1007548121 6:42709401-42709423 CAGGAGGGACAAGGGAGGTGGGG - Intronic
1007729888 6:43939437-43939459 CTGGTGGGGCAAGGGGCAGGGGG - Intergenic
1007767761 6:44171048-44171070 CTGGAGGGACAATGGGCTGGAGG + Intronic
1009441745 6:63688258-63688280 GAGGGGGGAGGAGGGGAGGGGGG - Intronic
1009842616 6:69095385-69095407 CATGGGGGGCAGGGGGCAGGGGG + Intronic
1010171848 6:72984646-72984668 CAGGAAGCACAAGGGGTGGGGGG - Intronic
1010940760 6:81915163-81915185 CAGTGGGGGGAAGGGGGGGGGGG - Intergenic
1011277252 6:85643150-85643172 CAGTGGGGTAAAGGAGCGGGGGG - Exonic
1013225763 6:108118532-108118554 CAGGGGGCGCAGGGGGCGGCCGG + Intronic
1015965385 6:138692393-138692415 CAGGGCCGCCAGGGGGCGGGCGG + Intronic
1016050771 6:139527809-139527831 CAGGGGTGACAGGGGGCAGGTGG + Intergenic
1016163380 6:140908472-140908494 GAGGGGGGAGAAGTGGCAGGGGG + Intergenic
1017738304 6:157382295-157382317 CAGGGGAGACCAGGGGAGTGCGG - Intronic
1018625138 6:165770898-165770920 ATGGGGGGACAATGGCCGGGTGG - Intronic
1018876679 6:167827350-167827372 GAGGGGAGAGAAGGGGCGGAGGG - Intronic
1019051579 6:169187994-169188016 CAGGGGGGACGGGGAGCGGGGGG - Intergenic
1019137737 6:169921912-169921934 CAGGGTGGAGGAGGGGCTGGCGG + Intergenic
1019402941 7:866717-866739 CCGGTGGGACGGGGGGCGGGGGG - Intronic
1019438474 7:1033918-1033940 CAGTGGGGACAGTGGGAGGGTGG - Intronic
1019562251 7:1664887-1664909 CAGGCTGGGGAAGGGGCGGGTGG + Intergenic
1019711343 7:2519545-2519567 CAGGGGCTACCCGGGGCGGGGGG + Intronic
1019925927 7:4191745-4191767 CAGGGTGGACAGGGGGCTGCAGG + Intronic
1020094708 7:5361861-5361883 CAGGGGCCCCACGGGGCGGGCGG + Intronic
1020308902 7:6854854-6854876 CAGGAGGGAGGAGGGGCTGGTGG + Intergenic
1021798745 7:24284083-24284105 CAGGGGCGGGAAGTGGCGGGTGG + Intergenic
1023712893 7:43013658-43013680 CAAGGGGGAGAAGGGGCAAGAGG + Intergenic
1023888564 7:44377119-44377141 CAGGAGGGACAAGGAGGGAGAGG - Intergenic
1024803497 7:53108480-53108502 CTGCAGGGGCAAGGGGCGGGGGG + Intergenic
1025198773 7:56949639-56949661 GAGGAGGGAGAAGGGGTGGGAGG - Intergenic
1025673173 7:63627294-63627316 GAGGAGGGAGAAGGGGTGGGAGG + Intergenic
1026764946 7:73154691-73154713 GAGGGGAGGCACGGGGCGGGTGG - Intergenic
1026805891 7:73429513-73429535 CAGGGTGGAGAAGCGTCGGGGGG - Intergenic
1026866633 7:73828087-73828109 CCGGGGGGGCAGGAGGCGGGCGG + Intronic
1027041418 7:74964461-74964483 GAGGGGAGGCACGGGGCGGGTGG - Intergenic
1027082222 7:75237915-75237937 GAGGGGAGGCACGGGGCGGGTGG + Intergenic
1029390785 7:100272418-100272440 GAGGGGAGGCACGGGGCGGGTGG + Intergenic
1029606268 7:101601221-101601243 CAGTGTGGAAAAGGGGCAGGTGG + Intergenic
1030735533 7:113043495-113043517 CAGGGAGCCCAAGGGGAGGGAGG + Intergenic
1031012960 7:116542800-116542822 CAGGTGGGAAAAGGGGGAGGGGG - Intronic
1031991752 7:128203144-128203166 CAGGAGGGACACGGGGAAGGTGG + Intergenic
1032504213 7:132423763-132423785 CAGGAGAGAGAAGGGGAGGGAGG - Intronic
1032784975 7:135193673-135193695 CTGGAATGACAAGGGGCGGGAGG + Intronic
1033648713 7:143323782-143323804 CACGCGGGACAAGGGGGTGGAGG - Intronic
1034445424 7:151111572-151111594 CAGGGGGGTGAGGGGCCGGGGGG - Intronic
1035023010 7:155809818-155809840 CAGGGCGGACGGGGGTCGGGGGG + Intronic
1035056689 7:156040635-156040657 CAGGGGGGAGAAGGGATGGATGG - Intergenic
1035172160 7:157022799-157022821 CAGGGTGGACCAGGGGCTGCTGG - Intergenic
1035207038 7:157300503-157300525 CAGGCTGGACACGTGGCGGGCGG - Intergenic
1035236457 7:157500707-157500729 CGGGGAGAACAAGGGGAGGGAGG - Intergenic
1035245443 7:157559829-157559851 CAGGAGAGAGACGGGGCGGGGGG - Intronic
1035726083 8:1825090-1825112 CAGGGGGGACAGGTGGGGTGCGG - Intronic
1036692223 8:10951238-10951260 CTGGGGGGACAAGGGCTGTGGGG + Intronic
1037467295 8:19172711-19172733 GAGGGGGGAGAAGGGACGGGAGG + Intergenic
1038103751 8:24410303-24410325 CAGTGGGGCCAAATGGCGGGTGG - Intergenic
1038816382 8:30909398-30909420 GAGGGGGGAGTGGGGGCGGGGGG - Intergenic
1039385685 8:37133826-37133848 CAGGGCTGATAAGAGGCGGGAGG - Intergenic
1039419049 8:37420368-37420390 CTGCGGGGACAGGAGGCGGGGGG - Intergenic
1039554718 8:38467831-38467853 CAGGAGGTGAAAGGGGCGGGCGG + Exonic
1047283565 8:123466645-123466667 CAGGGGGGAAAAGGGAGGAGGGG - Intronic
1047736908 8:127773749-127773771 GGTGGGGGACAAGGGGAGGGAGG + Intergenic
1047786290 8:128156790-128156812 CAGGGAGGCTAAGAGGCGGGAGG + Intergenic
1048416154 8:134229844-134229866 CAGCGGGGAGCAGGGGTGGGGGG + Intergenic
1048494730 8:134925683-134925705 CATGGGGTAGAAGGGGCTGGAGG + Intergenic
1048939996 8:139392317-139392339 AAAGGGAGACAAGGGGCAGGTGG - Intergenic
1048972091 8:139650868-139650890 CGGGGGTGTCAAGGGGCTGGTGG - Intronic
1049198038 8:141326089-141326111 CAGGGAGGGCGAGGGGCCGGGGG + Intergenic
1049233296 8:141495284-141495306 CAGGGGGCAGAGGGGGAGGGTGG - Intergenic
1049417143 8:142500354-142500376 CAGGGGAGGAAAGGCGCGGGGGG - Intronic
1049643305 8:143725145-143725167 GAGGGGGGAGACGGGGGGGGGGG + Exonic
1050460827 9:5875969-5875991 CAGAGGGGCCATGGGGCAGGGGG + Intergenic
1054857242 9:69914339-69914361 CAGGAGGCAGAAGGGGTGGGGGG - Intergenic
1055397900 9:75892666-75892688 CGGCGGGGAGGAGGGGCGGGGGG - Intronic
1057247251 9:93467248-93467270 AATGGGGGAAAAGGGGGGGGGGG - Intronic
1057599948 9:96449623-96449645 GAGGGGTGACAAGGGGTTGGAGG - Intergenic
1058612909 9:106794209-106794231 CAGGGGGGATCGGGGGCGGGGGG + Intergenic
1059517761 9:114911726-114911748 TAGGTGGGGCAGGGGGCGGGGGG - Intronic
1060016913 9:120094666-120094688 CAGGGGACACACAGGGCGGGGGG + Intergenic
1060106979 9:120878659-120878681 CAGGGGGATCAAGGGGCAGAAGG - Intronic
1060186514 9:121567156-121567178 CAGGTGGGGCCAGGGGCTGGGGG + Exonic
1061315919 9:129795720-129795742 CAGGAGAGAGAAGGGGCGGGGGG + Intergenic
1062215301 9:135385894-135385916 CAGGGTGGGCACGGGGAGGGTGG - Intergenic
1062219161 9:135405035-135405057 CCTGGGGGACAAGGGGTAGGAGG - Intergenic
1062233798 9:135498540-135498562 CATGGGGGGCAGGGGGTGGGTGG - Intronic
1062389283 9:136327625-136327647 CAGGGCGGGCAGGGGGCGGACGG + Exonic
1062526252 9:136979130-136979152 CAGGTGGGACAGCGGGCAGGTGG + Exonic
1062544131 9:137054098-137054120 GGGGCGGGACGAGGGGCGGGAGG + Intergenic
1062615925 9:137395639-137395661 CAGGGAGGGCAGGGGGTGGGAGG + Intronic
1185467000 X:361087-361109 GAGGGGAGAGAAGGGGAGGGTGG + Intronic
1185603636 X:1355089-1355111 CAGGAGGAAGAAGGAGCGGGAGG + Intronic
1185791162 X:2928996-2929018 CTGAGGGGACGAAGGGCGGGTGG - Intronic
1186501763 X:10056537-10056559 CAGTGGTGACCAGGGGCTGGGGG - Intronic
1189234302 X:39475776-39475798 CAGGAGGGACAAGCCGAGGGAGG + Intergenic
1189326873 X:40117987-40118009 GAGGGAGGAAAAGGGGTGGGGGG - Intronic
1190054775 X:47175207-47175229 AAGGGGAGAGAGGGGGCGGGGGG - Intronic
1192251432 X:69417032-69417054 GGGGGGGGAGAGGGGGCGGGGGG - Intergenic
1192698903 X:73447339-73447361 CAGGCGGCACAGGGGGCGGTGGG + Exonic
1193072882 X:77324869-77324891 GAGGTGGGAGAAGGGGGGGGAGG + Intergenic
1195668249 X:107449576-107449598 GGGAGGGGAGAAGGGGCGGGGGG - Intergenic
1196016419 X:110944689-110944711 CTGGGAGGGCACGGGGCGGGAGG + Intronic
1196423149 X:115543435-115543457 AAGGGGGGAAAAAGGGGGGGTGG - Intergenic
1196706831 X:118724275-118724297 CATGGGGGACAGTGGGTGGGTGG + Intergenic
1198730248 X:139720617-139720639 CAGGGAGGCTAAGAGGCGGGAGG + Intergenic
1199976530 X:152897891-152897913 CGGGGCCGAGAAGGGGCGGGCGG + Intergenic
1200002637 X:153069919-153069941 CAAGGGGGAGAAGCGGTGGGGGG + Intergenic
1200005086 X:153080090-153080112 CAAGGGGGAGAAGCGGTGGGGGG - Intergenic
1200179848 X:154143654-154143676 CATGGGGGGCAAGGGGGAGGAGG + Intergenic
1200223388 X:154403226-154403248 CAGGAGGGACAAGGATAGGGTGG - Intronic